Incidental Mutation 'R6294:Oxct1'
ID508634
Institutional Source Beutler Lab
Gene Symbol Oxct1
Ensembl Gene ENSMUSG00000022186
Gene Name3-oxoacid CoA transferase 1
Synonyms2610008O03Rik, Scot-s
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6294 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location4026383-4155344 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 4142822 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 457 (T457A)
Ref Sequence ENSEMBL: ENSMUSP00000116343 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110690] [ENSMUST00000138927]
Predicted Effect probably benign
Transcript: ENSMUST00000110690
AA Change: T457A

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000106318
Gene: ENSMUSG00000022186
AA Change: T457A

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
CoA_trans 43 272 2.41e-86 SMART
low complexity region 286 299 N/A INTRINSIC
CoA_trans 303 501 5.18e-77 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124591
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133130
Predicted Effect possibly damaging
Transcript: ENSMUST00000138927
AA Change: T457A

PolyPhen 2 Score 0.524 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000116343
Gene: ENSMUSG00000022186
AA Change: T457A

DomainStartEndE-ValueType
low complexity region 2 24 N/A INTRINSIC
CoA_trans 43 272 2.41e-86 SMART
low complexity region 286 299 N/A INTRINSIC
CoA_trans 303 484 3.1e-57 SMART
Meta Mutation Damage Score 0.062 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 99% (71/72)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the 3-oxoacid CoA-transferase gene family. The encoded protein is a homodimeric mitochondrial matrix enzyme that plays a central role in extrahepatic ketone body catabolism by catalyzing the reversible transfer of coenzyme A from succinyl-CoA to acetoacetate. Mutations in this gene are associated with succinyl CoA:3-oxoacid CoA transferase deficiency. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit hyperketonemia, ketoacidosis, increased glucose oxidation in the brain, increased autophagy in the brain, and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,654,481 H579L probably benign Het
Aldh2 G A 5: 121,572,816 Q8* probably null Het
Ankdd1a G T 9: 65,520,164 H10Q probably benign Het
Arpp21 A G 9: 112,127,452 F453L probably damaging Het
Birc6 C A 17: 74,689,257 D4461E probably benign Het
Cacna1b A T 2: 24,719,057 S411T possibly damaging Het
Camk2g A G 14: 20,764,949 I203T probably damaging Het
Cat A T 2: 103,460,295 C425S probably benign Het
Ccdc34 A G 2: 110,018,151 D95G probably benign Het
Clca4b T C 3: 144,925,185 S305G probably null Het
Cul7 T C 17: 46,663,148 I1453T probably benign Het
Dlg1 T A 16: 31,838,124 I612N probably damaging Het
Dync2h1 T G 9: 7,084,986 K561T probably benign Het
Erbin T C 13: 103,857,056 T359A probably benign Het
Far2 T A 6: 148,157,482 L222Q probably damaging Het
Fbxw17 A G 13: 50,423,803 E114G probably benign Het
Fryl A T 5: 73,191,759 probably benign Het
Ggn A G 7: 29,173,848 D666G possibly damaging Het
Hal G A 10: 93,514,143 probably null Het
Htt A G 5: 34,821,826 D851G probably benign Het
Ighv14-2 A T 12: 113,994,598 D74E probably benign Het
Igkv5-43 G A 6: 69,823,442 S87L probably damaging Het
Klhl29 A T 12: 5,083,995 F720I probably damaging Het
Klk1b8 T A 7: 43,952,772 Y43N probably damaging Het
Krtap6-3 T A 16: 89,084,101 Y7N unknown Het
Lama4 T A 10: 39,075,470 F1070L probably damaging Het
Map4 A G 9: 110,002,746 E98G possibly damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mki67 A G 7: 135,704,590 M581T probably benign Het
Mtss1l T A 8: 110,727,328 N43K possibly damaging Het
Mylk3 T A 8: 85,350,383 I475F probably damaging Het
Nat14 C T 7: 4,924,074 R82* probably null Het
Nckap1 T C 2: 80,541,514 N324S probably benign Het
Nemp1 C T 10: 127,694,522 T281M possibly damaging Het
Nrg3 A T 14: 38,397,239 H425Q probably benign Het
Olfr101 T A 17: 37,299,553 T290S probably benign Het
Olfr1318 A G 2: 112,156,019 I23V probably benign Het
Olfr1487 T C 19: 13,619,366 V25A probably benign Het
Olfr584 A T 7: 103,085,667 I45F probably benign Het
Olfr622 A G 7: 103,639,591 M183T probably damaging Het
Olfr95 T C 17: 37,211,626 T76A probably benign Het
Omd T A 13: 49,589,991 N172K probably damaging Het
Orc1 T C 4: 108,590,670 I38T probably benign Het
Pcdh17 A T 14: 84,477,668 K924N probably benign Het
Pkhd1l1 A T 15: 44,570,028 I3435F probably damaging Het
Psg20 C A 7: 18,682,679 V171F probably damaging Het
Rab11fip2 A T 19: 59,937,099 S87T probably damaging Het
Rabgap1l T C 1: 160,231,849 T237A probably benign Het
Rasgrp1 A T 2: 117,291,792 Y372* probably null Het
Rell1 G T 5: 63,939,705 probably benign Het
Rps14 A G 18: 60,776,961 K61E possibly damaging Het
Rtl6 A G 15: 84,557,120 V25A possibly damaging Het
Ryr2 G T 13: 11,879,496 S185R probably damaging Het
Slc10a2 C T 8: 5,091,621 probably null Het
Slc14a1 T A 18: 78,110,058 probably null Het
Smad2 A T 18: 76,289,162 N215I probably benign Het
Smchd1 A T 17: 71,370,927 N1473K probably benign Het
Spag9 A G 11: 94,093,485 probably null Het
Stk31 A C 6: 49,417,344 R213S probably benign Het
Tmod4 A T 3: 95,128,306 Q255L probably benign Het
Tnpo1 T A 13: 98,890,774 Y3F probably benign Het
Tom1l1 A C 11: 90,661,761 Y206* probably null Het
Tulp2 A G 7: 45,514,692 K36E probably damaging Het
Tulp4 C T 17: 6,201,819 R282C probably damaging Het
Unc5b A T 10: 60,778,331 N246K possibly damaging Het
Ush2a C G 1: 188,536,370 S1674R possibly damaging Het
Vmn1r224 T C 17: 20,419,821 I220T probably benign Het
Vmn1r7 G C 6: 57,024,419 N285K probably benign Het
Vmn2r83 C T 10: 79,477,854 P99S probably damaging Het
Zbtb38 A G 9: 96,687,229 F601L probably benign Het
Zc3h3 A T 15: 75,809,568 S555T possibly damaging Het
Other mutations in Oxct1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00491:Oxct1 APN 15 4096514 missense probably damaging 0.99
IGL00870:Oxct1 APN 15 4101818 missense probably damaging 1.00
IGL01068:Oxct1 APN 15 4053764 missense probably damaging 1.00
IGL01681:Oxct1 APN 15 4101844 missense possibly damaging 0.80
IGL02040:Oxct1 APN 15 4026768 utr 5 prime probably benign
IGL02149:Oxct1 APN 15 4091229 missense probably damaging 0.98
IGL02327:Oxct1 APN 15 4037089 critical splice acceptor site probably null
IGL03108:Oxct1 APN 15 4035282 missense probably benign 0.05
IGL03146:Oxct1 APN 15 4101148 missense probably damaging 0.99
IGL03195:Oxct1 APN 15 4101189 missense possibly damaging 0.50
kettle UTSW 15 4035330 missense probably benign 0.38
R1169:Oxct1 UTSW 15 4091226 missense probably damaging 1.00
R1487:Oxct1 UTSW 15 4147575 missense possibly damaging 0.87
R2011:Oxct1 UTSW 15 4153761 missense probably benign 0.36
R2069:Oxct1 UTSW 15 4092525 missense probably null 0.99
R3691:Oxct1 UTSW 15 4047517 missense probably benign 0.02
R3930:Oxct1 UTSW 15 4037119 missense possibly damaging 0.92
R3931:Oxct1 UTSW 15 4037119 missense possibly damaging 0.92
R5137:Oxct1 UTSW 15 4035350 missense probably benign 0.00
R5165:Oxct1 UTSW 15 4053769 missense possibly damaging 0.87
R5554:Oxct1 UTSW 15 4091195 missense probably benign 0.01
R5650:Oxct1 UTSW 15 4142850 missense probably damaging 1.00
R6225:Oxct1 UTSW 15 4035330 missense probably benign 0.38
R6395:Oxct1 UTSW 15 4026827 missense possibly damaging 0.73
R6736:Oxct1 UTSW 15 4092417 missense probably benign
R7195:Oxct1 UTSW 15 4128901 missense probably damaging 0.99
R7204:Oxct1 UTSW 15 4094042 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTTTCCCAGGGGTGATAGC -3'
(R):5'- CACAGACTAATGTAATCTCGTGGC -3'

Sequencing Primer
(F):5'- TCCCAGGGGTGATAGCTACCTAAAG -3'
(R):5'- CTCGTGGCTACTGACGTGATATAAC -3'
Posted On2018-03-15