Incidental Mutation 'R6294:Pkhd1l1'
ID 508635
Institutional Source Beutler Lab
Gene Symbol Pkhd1l1
Ensembl Gene ENSMUSG00000038725
Gene Name polycystic kidney and hepatic disease 1-like 1
Synonyms PKHDL1, D86 mRNA, fibrocystin L
MMRRC Submission 044406-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6294 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 44457494-44601369 bp(+) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 44570028 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 3435 (I3435F)
Ref Sequence ENSEMBL: ENSMUSP00000147447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038336] [ENSMUST00000166957] [ENSMUST00000209244]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000038336
AA Change: I3435F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036988
Gene: ENSMUSG00000038725
AA Change: I3435F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 1.6e-16 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1322 1.1e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 5.1e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 2.1e-10 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000166957
AA Change: I3435F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129522
Gene: ENSMUSG00000038725
AA Change: I3435F

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
IPT 30 141 9.02e-3 SMART
Pfam:TIG 146 255 9.4e-18 PFAM
IPT 269 362 2.27e-8 SMART
PbH1 398 420 2.98e3 SMART
IPT 1066 1154 5.34e-5 SMART
IPT 1156 1235 1.44e-1 SMART
Pfam:TIG 1240 1323 3e-13 PFAM
IPT 1328 1407 7.06e0 SMART
Pfam:TIG 1565 1645 3.7e-11 PFAM
IPT 1657 1743 1.89e-5 SMART
Pfam:TIG 1748 1828 9.7e-12 PFAM
IPT 1829 1910 4.87e-8 SMART
IPT 1914 1997 6.84e-3 SMART
IPT 1998 2085 9.86e-1 SMART
IPT 2089 2176 7.21e-11 SMART
PbH1 2105 2126 1.56e3 SMART
G8 2183 2303 2.37e-59 SMART
PbH1 2484 2506 9.48e3 SMART
PbH1 2507 2529 8.45e2 SMART
PbH1 2565 2587 4.11e3 SMART
PbH1 2664 2686 3.5e3 SMART
PbH1 2732 2755 2.7e3 SMART
Blast:G8 2949 2979 1e-5 BLAST
low complexity region 3014 3025 N/A INTRINSIC
G8 3035 3173 6.5e-57 SMART
PbH1 3292 3314 1.96e3 SMART
PbH1 3354 3376 3.79e1 SMART
PbH1 3415 3437 4.87e2 SMART
PbH1 3470 3492 8.34e3 SMART
PbH1 3493 3514 5.86e3 SMART
low complexity region 3563 3574 N/A INTRINSIC
low complexity region 4076 4103 N/A INTRINSIC
low complexity region 4184 4212 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000209244
AA Change: I3435F

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.1400 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 96.2%
Validation Efficiency 99% (71/72)
Allele List at MGI
Other mutations in this stock
Total: 71 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2m A T 6: 121,654,481 (GRCm38) H579L probably benign Het
Aldh2 G A 5: 121,572,816 (GRCm38) Q8* probably null Het
Ankdd1a G T 9: 65,520,164 (GRCm38) H10Q probably benign Het
Arpp21 A G 9: 112,127,452 (GRCm38) F453L probably damaging Het
Birc6 C A 17: 74,689,257 (GRCm38) D4461E probably benign Het
Cacna1b A T 2: 24,719,057 (GRCm38) S411T possibly damaging Het
Camk2g A G 14: 20,764,949 (GRCm38) I203T probably damaging Het
Cat A T 2: 103,460,295 (GRCm38) C425S probably benign Het
Ccdc34 A G 2: 110,018,151 (GRCm38) D95G probably benign Het
Clca4b T C 3: 144,925,185 (GRCm38) S305G probably null Het
Cul7 T C 17: 46,663,148 (GRCm38) I1453T probably benign Het
Dlg1 T A 16: 31,838,124 (GRCm38) I612N probably damaging Het
Dync2h1 T G 9: 7,084,986 (GRCm38) K561T probably benign Het
Erbin T C 13: 103,857,056 (GRCm38) T359A probably benign Het
Far2 T A 6: 148,157,482 (GRCm38) L222Q probably damaging Het
Fbxw17 A G 13: 50,423,803 (GRCm38) E114G probably benign Het
Fryl A T 5: 73,191,759 (GRCm38) probably benign Het
Ggn A G 7: 29,173,848 (GRCm38) D666G possibly damaging Het
Hal G A 10: 93,514,143 (GRCm38) probably null Het
Htt A G 5: 34,821,826 (GRCm38) D851G probably benign Het
Ighv14-2 A T 12: 113,994,598 (GRCm38) D74E probably benign Het
Igkv5-43 G A 6: 69,823,442 (GRCm38) S87L probably damaging Het
Klhl29 A T 12: 5,083,995 (GRCm38) F720I probably damaging Het
Klk1b8 T A 7: 43,952,772 (GRCm38) Y43N probably damaging Het
Krtap6-3 T A 16: 89,084,101 (GRCm38) Y7N unknown Het
Lama4 T A 10: 39,075,470 (GRCm38) F1070L probably damaging Het
Map4 A G 9: 110,002,746 (GRCm38) E98G possibly damaging Het
Mbtd1 C T 11: 93,932,232 (GRCm38) H493Y possibly damaging Het
Mki67 A G 7: 135,704,590 (GRCm38) M581T probably benign Het
Mtss2 T A 8: 110,727,328 (GRCm38) N43K possibly damaging Het
Mylk3 T A 8: 85,350,383 (GRCm38) I475F probably damaging Het
Nat14 C T 7: 4,924,074 (GRCm38) R82* probably null Het
Nckap1 T C 2: 80,541,514 (GRCm38) N324S probably benign Het
Nemp1 C T 10: 127,694,522 (GRCm38) T281M possibly damaging Het
Nrg3 A T 14: 38,397,239 (GRCm38) H425Q probably benign Het
Omd T A 13: 49,589,991 (GRCm38) N172K probably damaging Het
Or10c1 T C 17: 37,211,626 (GRCm38) T76A probably benign Het
Or12d12 T A 17: 37,299,553 (GRCm38) T290S probably benign Het
Or4f62 A G 2: 112,156,019 (GRCm38) I23V probably benign Het
Or52a33 A G 7: 103,639,591 (GRCm38) M183T probably damaging Het
Or52r1c A T 7: 103,085,667 (GRCm38) I45F probably benign Het
Or5b123 T C 19: 13,619,366 (GRCm38) V25A probably benign Het
Orc1 T C 4: 108,590,670 (GRCm38) I38T probably benign Het
Oxct1 A G 15: 4,142,822 (GRCm38) T457A possibly damaging Het
Pcdh17 A T 14: 84,477,668 (GRCm38) K924N probably benign Het
Psg20 C A 7: 18,682,679 (GRCm38) V171F probably damaging Het
Rab11fip2 A T 19: 59,937,099 (GRCm38) S87T probably damaging Het
Rabgap1l T C 1: 160,231,849 (GRCm38) T237A probably benign Het
Rasgrp1 A T 2: 117,291,792 (GRCm38) Y372* probably null Het
Rell1 G T 5: 63,939,705 (GRCm38) probably benign Het
Rps14 A G 18: 60,776,961 (GRCm38) K61E possibly damaging Het
Rtl6 A G 15: 84,557,120 (GRCm38) V25A possibly damaging Het
Ryr2 G T 13: 11,879,496 (GRCm38) S185R probably damaging Het
Slc10a2 C T 8: 5,091,621 (GRCm38) probably null Het
Slc14a1 T A 18: 78,110,058 (GRCm38) probably null Het
Smad2 A T 18: 76,289,162 (GRCm38) N215I probably benign Het
Smchd1 A T 17: 71,370,927 (GRCm38) N1473K probably benign Het
Spag9 A G 11: 94,093,485 (GRCm38) probably null Het
Stk31 A C 6: 49,417,344 (GRCm38) R213S probably benign Het
Tmod4 A T 3: 95,128,306 (GRCm38) Q255L probably benign Het
Tnpo1 T A 13: 98,890,774 (GRCm38) Y3F probably benign Het
Tom1l1 A C 11: 90,661,761 (GRCm38) Y206* probably null Het
Tulp2 A G 7: 45,514,692 (GRCm38) K36E probably damaging Het
Tulp4 C T 17: 6,201,819 (GRCm38) R282C probably damaging Het
Unc5b A T 10: 60,778,331 (GRCm38) N246K possibly damaging Het
Ush2a C G 1: 188,536,370 (GRCm38) S1674R possibly damaging Het
Vmn1r224 T C 17: 20,419,821 (GRCm38) I220T probably benign Het
Vmn1r7 G C 6: 57,024,419 (GRCm38) N285K probably benign Het
Vmn2r83 C T 10: 79,477,854 (GRCm38) P99S probably damaging Het
Zbtb38 A G 9: 96,687,229 (GRCm38) F601L probably benign Het
Zc3h3 A T 15: 75,809,568 (GRCm38) S555T possibly damaging Het
Other mutations in Pkhd1l1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00233:Pkhd1l1 APN 15 44,477,586 (GRCm38) missense probably damaging 1.00
IGL00235:Pkhd1l1 APN 15 44,556,019 (GRCm38) missense probably damaging 1.00
IGL00264:Pkhd1l1 APN 15 44,491,029 (GRCm38) missense possibly damaging 0.67
IGL00537:Pkhd1l1 APN 15 44,591,992 (GRCm38) missense possibly damaging 0.88
IGL00537:Pkhd1l1 APN 15 44,500,047 (GRCm38) missense probably benign 0.42
IGL00580:Pkhd1l1 APN 15 44,586,474 (GRCm38) missense probably damaging 0.98
IGL01085:Pkhd1l1 APN 15 44,562,752 (GRCm38) splice site probably null
IGL01089:Pkhd1l1 APN 15 44,483,869 (GRCm38) splice site probably benign
IGL01094:Pkhd1l1 APN 15 44,546,929 (GRCm38) missense probably benign 0.09
IGL01120:Pkhd1l1 APN 15 44,505,312 (GRCm38) critical splice donor site probably null
IGL01307:Pkhd1l1 APN 15 44,530,029 (GRCm38) missense possibly damaging 0.82
IGL01362:Pkhd1l1 APN 15 44,532,982 (GRCm38) missense probably benign 0.00
IGL01403:Pkhd1l1 APN 15 44,483,833 (GRCm38) nonsense probably null
IGL01546:Pkhd1l1 APN 15 44,566,316 (GRCm38) missense probably damaging 1.00
IGL01596:Pkhd1l1 APN 15 44,529,410 (GRCm38) missense possibly damaging 0.50
IGL01696:Pkhd1l1 APN 15 44,529,351 (GRCm38) missense possibly damaging 0.79
IGL01844:Pkhd1l1 APN 15 44,499,400 (GRCm38) splice site probably benign
IGL02007:Pkhd1l1 APN 15 44,533,733 (GRCm38) splice site probably benign
IGL02041:Pkhd1l1 APN 15 44,493,056 (GRCm38) splice site probably null
IGL02171:Pkhd1l1 APN 15 44,516,146 (GRCm38) missense possibly damaging 0.80
IGL02206:Pkhd1l1 APN 15 44,512,849 (GRCm38) missense probably benign 0.08
IGL02266:Pkhd1l1 APN 15 44,573,614 (GRCm38) missense probably damaging 1.00
IGL02487:Pkhd1l1 APN 15 44,459,426 (GRCm38) missense possibly damaging 0.65
IGL02488:Pkhd1l1 APN 15 44,558,597 (GRCm38) missense probably benign
IGL02522:Pkhd1l1 APN 15 44,555,902 (GRCm38) missense possibly damaging 0.71
IGL02554:Pkhd1l1 APN 15 44,578,500 (GRCm38) missense probably damaging 1.00
IGL02566:Pkhd1l1 APN 15 44,526,054 (GRCm38) splice site probably null
IGL02602:Pkhd1l1 APN 15 44,557,931 (GRCm38) missense probably damaging 1.00
IGL02606:Pkhd1l1 APN 15 44,589,456 (GRCm38) missense probably benign 0.00
IGL02623:Pkhd1l1 APN 15 44,584,873 (GRCm38) missense probably damaging 1.00
IGL02634:Pkhd1l1 APN 15 44,539,667 (GRCm38) missense probably damaging 1.00
IGL02637:Pkhd1l1 APN 15 44,564,324 (GRCm38) missense probably damaging 1.00
IGL02651:Pkhd1l1 APN 15 44,483,814 (GRCm38) missense probably damaging 1.00
IGL02679:Pkhd1l1 APN 15 44,530,045 (GRCm38) critical splice donor site probably null
IGL02684:Pkhd1l1 APN 15 44,516,209 (GRCm38) critical splice donor site probably null
IGL02739:Pkhd1l1 APN 15 44,540,950 (GRCm38) missense probably benign 0.11
IGL02831:Pkhd1l1 APN 15 44,501,493 (GRCm38) missense probably benign 0.18
IGL02839:Pkhd1l1 APN 15 44,529,543 (GRCm38) missense probably damaging 0.98
IGL02944:Pkhd1l1 APN 15 44,501,531 (GRCm38) missense probably damaging 1.00
IGL02957:Pkhd1l1 APN 15 44,512,908 (GRCm38) missense probably damaging 1.00
IGL03001:Pkhd1l1 APN 15 44,558,004 (GRCm38) missense probably damaging 1.00
IGL03030:Pkhd1l1 APN 15 44,596,902 (GRCm38) missense probably benign 0.41
IGL03030:Pkhd1l1 APN 15 44,591,976 (GRCm38) missense probably benign 0.00
IGL03132:Pkhd1l1 APN 15 44,574,617 (GRCm38) missense probably damaging 1.00
IGL03194:Pkhd1l1 APN 15 44,518,135 (GRCm38) missense probably damaging 1.00
IGL03219:Pkhd1l1 APN 15 44,596,895 (GRCm38) missense possibly damaging 0.62
IGL03236:Pkhd1l1 APN 15 44,581,826 (GRCm38) missense probably damaging 1.00
IGL03266:Pkhd1l1 APN 15 44,538,952 (GRCm38) missense probably damaging 1.00
IGL03276:Pkhd1l1 APN 15 44,594,584 (GRCm38) missense possibly damaging 0.77
IGL03284:Pkhd1l1 APN 15 44,547,518 (GRCm38) splice site probably benign
IGL03377:Pkhd1l1 APN 15 44,484,351 (GRCm38) splice site probably null
R0310_Pkhd1l1_251 UTSW 15 44,522,738 (GRCm38) splice site probably benign
R0344_Pkhd1l1_462 UTSW 15 44,597,011 (GRCm38) missense probably benign 0.15
R1737_Pkhd1l1_815 UTSW 15 44,547,509 (GRCm38) critical splice donor site probably null
R5049_Pkhd1l1_556 UTSW 15 44,457,616 (GRCm38) missense probably benign 0.00
K7371:Pkhd1l1 UTSW 15 44,500,067 (GRCm38) missense possibly damaging 0.94
K7371:Pkhd1l1 UTSW 15 44,537,442 (GRCm38) missense possibly damaging 0.67
N/A - 287:Pkhd1l1 UTSW 15 44,582,258 (GRCm38) missense probably damaging 0.98
P4717OSA:Pkhd1l1 UTSW 15 44,528,247 (GRCm38) missense probably damaging 1.00
P4717OSA:Pkhd1l1 UTSW 15 44,523,499 (GRCm38) missense probably benign 0.17
R0007:Pkhd1l1 UTSW 15 44,574,398 (GRCm38) splice site probably benign
R0020:Pkhd1l1 UTSW 15 44,556,872 (GRCm38) missense probably damaging 1.00
R0034:Pkhd1l1 UTSW 15 44,504,009 (GRCm38) missense probably benign 0.00
R0040:Pkhd1l1 UTSW 15 44,573,625 (GRCm38) missense probably damaging 1.00
R0050:Pkhd1l1 UTSW 15 44,573,807 (GRCm38) missense possibly damaging 0.79
R0050:Pkhd1l1 UTSW 15 44,573,807 (GRCm38) missense possibly damaging 0.79
R0063:Pkhd1l1 UTSW 15 44,529,237 (GRCm38) missense probably damaging 1.00
R0063:Pkhd1l1 UTSW 15 44,529,237 (GRCm38) missense probably damaging 1.00
R0086:Pkhd1l1 UTSW 15 44,556,008 (GRCm38) missense possibly damaging 0.94
R0103:Pkhd1l1 UTSW 15 44,597,141 (GRCm38) missense probably benign
R0103:Pkhd1l1 UTSW 15 44,597,141 (GRCm38) missense probably benign
R0127:Pkhd1l1 UTSW 15 44,554,605 (GRCm38) missense probably damaging 0.99
R0226:Pkhd1l1 UTSW 15 44,526,784 (GRCm38) missense possibly damaging 0.65
R0268:Pkhd1l1 UTSW 15 44,597,011 (GRCm38) missense probably benign 0.15
R0294:Pkhd1l1 UTSW 15 44,560,435 (GRCm38) missense probably benign 0.05
R0310:Pkhd1l1 UTSW 15 44,522,738 (GRCm38) splice site probably benign
R0344:Pkhd1l1 UTSW 15 44,597,011 (GRCm38) missense probably benign 0.15
R0449:Pkhd1l1 UTSW 15 44,501,519 (GRCm38) missense probably damaging 1.00
R0492:Pkhd1l1 UTSW 15 44,519,690 (GRCm38) missense probably benign 0.03
R0505:Pkhd1l1 UTSW 15 44,589,418 (GRCm38) missense probably damaging 1.00
R0529:Pkhd1l1 UTSW 15 44,526,754 (GRCm38) missense possibly damaging 0.62
R0543:Pkhd1l1 UTSW 15 44,523,491 (GRCm38) critical splice acceptor site probably null
R0552:Pkhd1l1 UTSW 15 44,489,546 (GRCm38) missense probably damaging 0.98
R0558:Pkhd1l1 UTSW 15 44,484,424 (GRCm38) missense probably damaging 0.97
R0609:Pkhd1l1 UTSW 15 44,467,424 (GRCm38) missense possibly damaging 0.48
R0619:Pkhd1l1 UTSW 15 44,483,838 (GRCm38) missense probably damaging 1.00
R0727:Pkhd1l1 UTSW 15 44,535,788 (GRCm38) missense possibly damaging 0.80
R0787:Pkhd1l1 UTSW 15 44,529,264 (GRCm38) missense probably damaging 1.00
R0846:Pkhd1l1 UTSW 15 44,495,597 (GRCm38) missense probably damaging 1.00
R0909:Pkhd1l1 UTSW 15 44,538,883 (GRCm38) splice site probably null
R0942:Pkhd1l1 UTSW 15 44,532,959 (GRCm38) missense probably benign 0.01
R1056:Pkhd1l1 UTSW 15 44,591,964 (GRCm38) missense probably damaging 1.00
R1147:Pkhd1l1 UTSW 15 44,537,441 (GRCm38) missense probably null 0.15
R1147:Pkhd1l1 UTSW 15 44,537,441 (GRCm38) missense probably null 0.15
R1187:Pkhd1l1 UTSW 15 44,498,051 (GRCm38) missense possibly damaging 0.65
R1328:Pkhd1l1 UTSW 15 44,497,996 (GRCm38) missense probably benign 0.01
R1331:Pkhd1l1 UTSW 15 44,589,597 (GRCm38) missense probably damaging 1.00
R1331:Pkhd1l1 UTSW 15 44,505,547 (GRCm38) missense probably damaging 1.00
R1332:Pkhd1l1 UTSW 15 44,505,547 (GRCm38) missense probably damaging 1.00
R1335:Pkhd1l1 UTSW 15 44,505,547 (GRCm38) missense probably damaging 1.00
R1338:Pkhd1l1 UTSW 15 44,526,724 (GRCm38) missense probably damaging 1.00
R1440:Pkhd1l1 UTSW 15 44,540,988 (GRCm38) splice site probably benign
R1445:Pkhd1l1 UTSW 15 44,505,644 (GRCm38) missense probably benign 0.32
R1458:Pkhd1l1 UTSW 15 44,516,115 (GRCm38) missense probably benign 0.01
R1469:Pkhd1l1 UTSW 15 44,536,886 (GRCm38) missense probably benign 0.45
R1469:Pkhd1l1 UTSW 15 44,536,886 (GRCm38) missense probably benign 0.45
R1500:Pkhd1l1 UTSW 15 44,545,494 (GRCm38) missense probably damaging 1.00
R1528:Pkhd1l1 UTSW 15 44,526,724 (GRCm38) missense probably damaging 1.00
R1542:Pkhd1l1 UTSW 15 44,528,191 (GRCm38) missense probably benign 0.44
R1568:Pkhd1l1 UTSW 15 44,545,501 (GRCm38) splice site probably null
R1571:Pkhd1l1 UTSW 15 44,526,841 (GRCm38) missense probably benign
R1572:Pkhd1l1 UTSW 15 44,543,473 (GRCm38) missense probably benign 0.01
R1604:Pkhd1l1 UTSW 15 44,467,367 (GRCm38) nonsense probably null
R1638:Pkhd1l1 UTSW 15 44,597,117 (GRCm38) missense probably benign 0.06
R1639:Pkhd1l1 UTSW 15 44,540,955 (GRCm38) missense probably damaging 0.99
R1737:Pkhd1l1 UTSW 15 44,547,509 (GRCm38) critical splice donor site probably null
R1816:Pkhd1l1 UTSW 15 44,528,239 (GRCm38) missense possibly damaging 0.91
R1826:Pkhd1l1 UTSW 15 44,503,345 (GRCm38) missense possibly damaging 0.75
R1880:Pkhd1l1 UTSW 15 44,525,242 (GRCm38) missense probably benign 0.13
R1930:Pkhd1l1 UTSW 15 44,503,337 (GRCm38) missense possibly damaging 0.69
R1933:Pkhd1l1 UTSW 15 44,540,884 (GRCm38) missense possibly damaging 0.48
R1938:Pkhd1l1 UTSW 15 44,500,038 (GRCm38) missense probably benign
R1975:Pkhd1l1 UTSW 15 44,529,713 (GRCm38) missense probably damaging 1.00
R1999:Pkhd1l1 UTSW 15 44,499,982 (GRCm38) splice site probably null
R2037:Pkhd1l1 UTSW 15 44,568,221 (GRCm38) splice site probably null
R2045:Pkhd1l1 UTSW 15 44,479,654 (GRCm38) missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44,581,741 (GRCm38) missense probably damaging 1.00
R2049:Pkhd1l1 UTSW 15 44,547,513 (GRCm38) splice site probably benign
R2063:Pkhd1l1 UTSW 15 44,550,752 (GRCm38) missense possibly damaging 0.69
R2072:Pkhd1l1 UTSW 15 44,558,639 (GRCm38) missense probably damaging 1.00
R2073:Pkhd1l1 UTSW 15 44,558,639 (GRCm38) missense probably damaging 1.00
R2075:Pkhd1l1 UTSW 15 44,558,639 (GRCm38) missense probably damaging 1.00
R2078:Pkhd1l1 UTSW 15 44,527,767 (GRCm38) missense probably benign 0.08
R2116:Pkhd1l1 UTSW 15 44,569,482 (GRCm38) missense probably damaging 0.97
R2133:Pkhd1l1 UTSW 15 44,516,185 (GRCm38) missense possibly damaging 0.91
R2138:Pkhd1l1 UTSW 15 44,501,457 (GRCm38) missense probably damaging 1.00
R2139:Pkhd1l1 UTSW 15 44,529,818 (GRCm38) missense possibly damaging 0.46
R2145:Pkhd1l1 UTSW 15 44,512,877 (GRCm38) splice site probably null
R2150:Pkhd1l1 UTSW 15 44,499,982 (GRCm38) splice site probably null
R2177:Pkhd1l1 UTSW 15 44,459,395 (GRCm38) missense probably benign
R2184:Pkhd1l1 UTSW 15 44,499,296 (GRCm38) missense possibly damaging 0.89
R2216:Pkhd1l1 UTSW 15 44,573,895 (GRCm38) missense probably damaging 1.00
R2226:Pkhd1l1 UTSW 15 44,512,792 (GRCm38) missense possibly damaging 0.79
R2227:Pkhd1l1 UTSW 15 44,512,792 (GRCm38) missense possibly damaging 0.79
R2243:Pkhd1l1 UTSW 15 44,546,927 (GRCm38) missense probably damaging 1.00
R2290:Pkhd1l1 UTSW 15 44,528,250 (GRCm38) missense probably benign 0.03
R2294:Pkhd1l1 UTSW 15 44,479,607 (GRCm38) missense probably damaging 0.99
R2346:Pkhd1l1 UTSW 15 44,560,506 (GRCm38) missense possibly damaging 0.82
R2356:Pkhd1l1 UTSW 15 44,533,019 (GRCm38) missense probably benign 0.00
R2386:Pkhd1l1 UTSW 15 44,528,178 (GRCm38) missense probably benign 0.00
R2404:Pkhd1l1 UTSW 15 44,550,820 (GRCm38) missense probably damaging 1.00
R2504:Pkhd1l1 UTSW 15 44,485,428 (GRCm38) missense probably damaging 0.97
R2679:Pkhd1l1 UTSW 15 44,545,386 (GRCm38) missense probably damaging 0.99
R2860:Pkhd1l1 UTSW 15 44,540,871 (GRCm38) missense probably damaging 1.00
R2861:Pkhd1l1 UTSW 15 44,540,871 (GRCm38) missense probably damaging 1.00
R2862:Pkhd1l1 UTSW 15 44,540,871 (GRCm38) missense probably damaging 1.00
R2972:Pkhd1l1 UTSW 15 44,547,248 (GRCm38) missense possibly damaging 0.65
R3016:Pkhd1l1 UTSW 15 44,545,370 (GRCm38) missense probably benign 0.02
R3162:Pkhd1l1 UTSW 15 44,505,528 (GRCm38) missense probably damaging 1.00
R3162:Pkhd1l1 UTSW 15 44,505,528 (GRCm38) missense probably damaging 1.00
R3416:Pkhd1l1 UTSW 15 44,547,364 (GRCm38) missense probably damaging 1.00
R3623:Pkhd1l1 UTSW 15 44,526,869 (GRCm38) missense probably damaging 1.00
R3687:Pkhd1l1 UTSW 15 44,546,587 (GRCm38) missense probably benign 0.17
R3755:Pkhd1l1 UTSW 15 44,589,406 (GRCm38) missense probably damaging 1.00
R3776:Pkhd1l1 UTSW 15 44,514,975 (GRCm38) critical splice donor site probably null
R3803:Pkhd1l1 UTSW 15 44,493,135 (GRCm38) missense probably benign 0.25
R3942:Pkhd1l1 UTSW 15 44,592,026 (GRCm38) critical splice donor site probably null
R4010:Pkhd1l1 UTSW 15 44,529,100 (GRCm38) missense possibly damaging 0.80
R4049:Pkhd1l1 UTSW 15 44,498,557 (GRCm38) missense probably damaging 1.00
R4059:Pkhd1l1 UTSW 15 44,550,760 (GRCm38) missense probably benign 0.01
R4179:Pkhd1l1 UTSW 15 44,523,649 (GRCm38) missense probably benign 0.45
R4184:Pkhd1l1 UTSW 15 44,591,906 (GRCm38) missense probably benign 0.00
R4369:Pkhd1l1 UTSW 15 44,505,553 (GRCm38) missense probably benign 0.00
R4462:Pkhd1l1 UTSW 15 44,581,804 (GRCm38) missense probably damaging 1.00
R4551:Pkhd1l1 UTSW 15 44,550,885 (GRCm38) missense probably damaging 1.00
R4618:Pkhd1l1 UTSW 15 44,539,682 (GRCm38) missense probably damaging 1.00
R4632:Pkhd1l1 UTSW 15 44,484,400 (GRCm38) missense probably benign 0.07
R4657:Pkhd1l1 UTSW 15 44,547,347 (GRCm38) missense probably damaging 1.00
R4716:Pkhd1l1 UTSW 15 44,556,032 (GRCm38) missense probably damaging 1.00
R4788:Pkhd1l1 UTSW 15 44,498,021 (GRCm38) missense probably damaging 0.99
R4828:Pkhd1l1 UTSW 15 44,529,405 (GRCm38) missense possibly damaging 0.55
R4858:Pkhd1l1 UTSW 15 44,491,101 (GRCm38) missense probably damaging 0.99
R4860:Pkhd1l1 UTSW 15 44,537,378 (GRCm38) missense possibly damaging 0.77
R4860:Pkhd1l1 UTSW 15 44,537,378 (GRCm38) missense possibly damaging 0.77
R4951:Pkhd1l1 UTSW 15 44,533,891 (GRCm38) missense possibly damaging 0.82
R4963:Pkhd1l1 UTSW 15 44,504,025 (GRCm38) missense probably benign 0.00
R5023:Pkhd1l1 UTSW 15 44,528,191 (GRCm38) missense probably benign 0.44
R5023:Pkhd1l1 UTSW 15 44,582,227 (GRCm38) missense probably benign 0.00
R5035:Pkhd1l1 UTSW 15 44,568,324 (GRCm38) missense probably damaging 1.00
R5049:Pkhd1l1 UTSW 15 44,457,616 (GRCm38) missense probably benign 0.00
R5065:Pkhd1l1 UTSW 15 44,582,293 (GRCm38) missense possibly damaging 0.68
R5089:Pkhd1l1 UTSW 15 44,591,887 (GRCm38) missense probably benign 0.01
R5151:Pkhd1l1 UTSW 15 44,505,309 (GRCm38) missense probably benign 0.00
R5153:Pkhd1l1 UTSW 15 44,505,309 (GRCm38) missense probably benign 0.00
R5189:Pkhd1l1 UTSW 15 44,547,148 (GRCm38) missense probably damaging 1.00
R5204:Pkhd1l1 UTSW 15 44,547,041 (GRCm38) missense possibly damaging 0.51
R5216:Pkhd1l1 UTSW 15 44,495,647 (GRCm38) nonsense probably null
R5286:Pkhd1l1 UTSW 15 44,514,972 (GRCm38) nonsense probably null
R5292:Pkhd1l1 UTSW 15 44,529,566 (GRCm38) missense probably damaging 1.00
R5293:Pkhd1l1 UTSW 15 44,535,750 (GRCm38) missense probably benign 0.01
R5298:Pkhd1l1 UTSW 15 44,504,046 (GRCm38) missense probably benign 0.00
R5327:Pkhd1l1 UTSW 15 44,546,862 (GRCm38) missense probably damaging 1.00
R5346:Pkhd1l1 UTSW 15 44,540,967 (GRCm38) missense probably damaging 1.00
R5481:Pkhd1l1 UTSW 15 44,558,646 (GRCm38) missense probably damaging 1.00
R5645:Pkhd1l1 UTSW 15 44,532,992 (GRCm38) missense probably benign 0.18
R5718:Pkhd1l1 UTSW 15 44,545,417 (GRCm38) missense probably damaging 1.00
R5809:Pkhd1l1 UTSW 15 44,519,707 (GRCm38) missense probably benign 0.03
R5816:Pkhd1l1 UTSW 15 44,566,322 (GRCm38) missense probably benign 0.01
R5854:Pkhd1l1 UTSW 15 44,581,790 (GRCm38) missense probably damaging 1.00
R5876:Pkhd1l1 UTSW 15 44,578,588 (GRCm38) missense possibly damaging 0.51
R5909:Pkhd1l1 UTSW 15 44,526,763 (GRCm38) missense probably damaging 1.00
R5950:Pkhd1l1 UTSW 15 44,532,965 (GRCm38) missense probably benign 0.00
R5961:Pkhd1l1 UTSW 15 44,459,463 (GRCm38) missense probably damaging 1.00
R5972:Pkhd1l1 UTSW 15 44,545,416 (GRCm38) missense probably damaging 1.00
R5975:Pkhd1l1 UTSW 15 44,525,988 (GRCm38) missense probably damaging 1.00
R5982:Pkhd1l1 UTSW 15 44,489,504 (GRCm38) splice site probably null
R6066:Pkhd1l1 UTSW 15 44,528,129 (GRCm38) missense probably damaging 0.99
R6122:Pkhd1l1 UTSW 15 44,557,940 (GRCm38) missense probably damaging 1.00
R6248:Pkhd1l1 UTSW 15 44,529,559 (GRCm38) missense probably benign
R6301:Pkhd1l1 UTSW 15 44,589,525 (GRCm38) missense probably damaging 0.99
R6526:Pkhd1l1 UTSW 15 44,498,089 (GRCm38) critical splice donor site probably null
R6707:Pkhd1l1 UTSW 15 44,529,143 (GRCm38) missense probably benign
R6736:Pkhd1l1 UTSW 15 44,557,940 (GRCm38) missense probably damaging 1.00
R6753:Pkhd1l1 UTSW 15 44,589,663 (GRCm38) missense probably benign 0.45
R6815:Pkhd1l1 UTSW 15 44,562,655 (GRCm38) missense probably damaging 1.00
R6874:Pkhd1l1 UTSW 15 44,589,527 (GRCm38) missense probably benign 0.06
R6942:Pkhd1l1 UTSW 15 44,522,629 (GRCm38) missense probably damaging 1.00
R6970:Pkhd1l1 UTSW 15 44,511,674 (GRCm38) missense possibly damaging 0.61
R6982:Pkhd1l1 UTSW 15 44,566,268 (GRCm38) missense probably damaging 0.97
R7103:Pkhd1l1 UTSW 15 44,573,631 (GRCm38) missense probably benign 0.02
R7116:Pkhd1l1 UTSW 15 44,557,976 (GRCm38) missense probably benign 0.00
R7135:Pkhd1l1 UTSW 15 44,584,978 (GRCm38) critical splice donor site probably null
R7143:Pkhd1l1 UTSW 15 44,573,637 (GRCm38) missense possibly damaging 0.93
R7177:Pkhd1l1 UTSW 15 44,467,404 (GRCm38) missense probably damaging 1.00
R7194:Pkhd1l1 UTSW 15 44,529,116 (GRCm38) missense probably damaging 1.00
R7204:Pkhd1l1 UTSW 15 44,523,553 (GRCm38) missense possibly damaging 0.90
R7215:Pkhd1l1 UTSW 15 44,528,163 (GRCm38) missense possibly damaging 0.78
R7218:Pkhd1l1 UTSW 15 44,522,695 (GRCm38) missense possibly damaging 0.49
R7225:Pkhd1l1 UTSW 15 44,546,941 (GRCm38) missense probably damaging 1.00
R7283:Pkhd1l1 UTSW 15 44,503,280 (GRCm38) missense probably benign 0.10
R7292:Pkhd1l1 UTSW 15 44,498,590 (GRCm38) missense probably benign
R7304:Pkhd1l1 UTSW 15 44,498,482 (GRCm38) missense possibly damaging 0.94
R7349:Pkhd1l1 UTSW 15 44,514,954 (GRCm38) missense probably damaging 1.00
R7359:Pkhd1l1 UTSW 15 44,589,486 (GRCm38) missense probably damaging 1.00
R7407:Pkhd1l1 UTSW 15 44,595,011 (GRCm38) missense possibly damaging 0.75
R7475:Pkhd1l1 UTSW 15 44,505,185 (GRCm38) nonsense probably null
R7481:Pkhd1l1 UTSW 15 44,512,911 (GRCm38) missense probably benign
R7554:Pkhd1l1 UTSW 15 44,495,470 (GRCm38) missense probably damaging 1.00
R7555:Pkhd1l1 UTSW 15 44,550,761 (GRCm38) missense possibly damaging 0.51
R7562:Pkhd1l1 UTSW 15 44,514,930 (GRCm38) missense possibly damaging 0.68
R7583:Pkhd1l1 UTSW 15 44,568,364 (GRCm38) critical splice donor site probably null
R7595:Pkhd1l1 UTSW 15 44,495,521 (GRCm38) missense probably damaging 1.00
R7749:Pkhd1l1 UTSW 15 44,527,737 (GRCm38) missense probably benign 0.00
R7754:Pkhd1l1 UTSW 15 44,586,408 (GRCm38) missense possibly damaging 0.94
R7761:Pkhd1l1 UTSW 15 44,529,884 (GRCm38) missense probably benign 0.00
R7774:Pkhd1l1 UTSW 15 44,540,907 (GRCm38) missense probably benign 0.03
R7785:Pkhd1l1 UTSW 15 44,543,569 (GRCm38) missense probably damaging 1.00
R7790:Pkhd1l1 UTSW 15 44,578,581 (GRCm38) missense probably damaging 1.00
R7804:Pkhd1l1 UTSW 15 44,597,138 (GRCm38) nonsense probably null
R7864:Pkhd1l1 UTSW 15 44,526,053 (GRCm38) critical splice donor site probably null
R7883:Pkhd1l1 UTSW 15 44,529,126 (GRCm38) missense probably damaging 1.00
R8031:Pkhd1l1 UTSW 15 44,512,834 (GRCm38) missense probably damaging 1.00
R8128:Pkhd1l1 UTSW 15 44,498,053 (GRCm38) missense possibly damaging 0.94
R8142:Pkhd1l1 UTSW 15 44,514,931 (GRCm38) missense probably benign 0.00
R8150:Pkhd1l1 UTSW 15 44,546,659 (GRCm38) missense possibly damaging 0.68
R8209:Pkhd1l1 UTSW 15 44,574,407 (GRCm38) missense possibly damaging 0.46
R8212:Pkhd1l1 UTSW 15 44,499,300 (GRCm38) missense probably benign 0.12
R8226:Pkhd1l1 UTSW 15 44,574,407 (GRCm38) missense possibly damaging 0.46
R8248:Pkhd1l1 UTSW 15 44,543,546 (GRCm38) missense probably damaging 0.99
R8299:Pkhd1l1 UTSW 15 44,581,934 (GRCm38) missense probably benign 0.26
R8425:Pkhd1l1 UTSW 15 44,574,515 (GRCm38) missense probably benign 0.01
R8485:Pkhd1l1 UTSW 15 44,560,400 (GRCm38) missense probably damaging 0.98
R8486:Pkhd1l1 UTSW 15 44,547,416 (GRCm38) missense probably damaging 1.00
R8701:Pkhd1l1 UTSW 15 44,574,683 (GRCm38) missense probably damaging 1.00
R8709:Pkhd1l1 UTSW 15 44,518,174 (GRCm38) missense probably benign 0.01
R8777:Pkhd1l1 UTSW 15 44,498,571 (GRCm38) missense probably damaging 1.00
R8777-TAIL:Pkhd1l1 UTSW 15 44,498,571 (GRCm38) missense probably damaging 1.00
R8845:Pkhd1l1 UTSW 15 44,505,254 (GRCm38) missense probably benign 0.30
R8846:Pkhd1l1 UTSW 15 44,546,962 (GRCm38) nonsense probably null
R8863:Pkhd1l1 UTSW 15 44,569,986 (GRCm38) nonsense probably null
R8917:Pkhd1l1 UTSW 15 44,533,007 (GRCm38) missense probably benign 0.04
R8936:Pkhd1l1 UTSW 15 44,538,916 (GRCm38) missense possibly damaging 0.94
R8962:Pkhd1l1 UTSW 15 44,536,895 (GRCm38) missense probably damaging 1.00
R8971:Pkhd1l1 UTSW 15 44,529,519 (GRCm38) missense possibly damaging 0.68
R8973:Pkhd1l1 UTSW 15 44,586,437 (GRCm38) missense probably damaging 1.00
R8982:Pkhd1l1 UTSW 15 44,523,673 (GRCm38) nonsense probably null
R8994:Pkhd1l1 UTSW 15 44,547,103 (GRCm38) missense probably damaging 0.99
R9004:Pkhd1l1 UTSW 15 44,543,372 (GRCm38) missense probably benign 0.16
R9064:Pkhd1l1 UTSW 15 44,562,642 (GRCm38) missense possibly damaging 0.93
R9173:Pkhd1l1 UTSW 15 44,520,756 (GRCm38) missense probably benign 0.09
R9185:Pkhd1l1 UTSW 15 44,589,623 (GRCm38) missense probably benign 0.01
R9213:Pkhd1l1 UTSW 15 44,495,478 (GRCm38) missense probably damaging 1.00
R9218:Pkhd1l1 UTSW 15 44,520,726 (GRCm38) missense possibly damaging 0.90
R9256:Pkhd1l1 UTSW 15 44,533,894 (GRCm38) critical splice donor site probably null
R9291:Pkhd1l1 UTSW 15 44,569,976 (GRCm38) missense probably damaging 1.00
R9309:Pkhd1l1 UTSW 15 44,536,893 (GRCm38) missense probably benign 0.00
R9319:Pkhd1l1 UTSW 15 44,529,578 (GRCm38) missense possibly damaging 0.46
R9339:Pkhd1l1 UTSW 15 44,589,553 (GRCm38) missense probably damaging 1.00
R9366:Pkhd1l1 UTSW 15 44,546,912 (GRCm38) missense probably benign 0.03
R9444:Pkhd1l1 UTSW 15 44,554,657 (GRCm38) missense probably benign 0.00
R9464:Pkhd1l1 UTSW 15 44,479,613 (GRCm38) missense probably damaging 1.00
R9525:Pkhd1l1 UTSW 15 44,584,926 (GRCm38) missense possibly damaging 0.88
R9542:Pkhd1l1 UTSW 15 44,546,888 (GRCm38) missense probably benign 0.12
R9544:Pkhd1l1 UTSW 15 44,546,843 (GRCm38) missense probably damaging 1.00
R9608:Pkhd1l1 UTSW 15 44,578,633 (GRCm38) missense possibly damaging 0.65
R9673:Pkhd1l1 UTSW 15 44,523,505 (GRCm38) missense probably benign 0.22
R9771:Pkhd1l1 UTSW 15 44,495,487 (GRCm38) missense probably benign
R9792:Pkhd1l1 UTSW 15 44,543,587 (GRCm38) missense probably benign 0.00
R9793:Pkhd1l1 UTSW 15 44,543,587 (GRCm38) missense probably benign 0.00
R9795:Pkhd1l1 UTSW 15 44,543,587 (GRCm38) missense probably benign 0.00
RF006:Pkhd1l1 UTSW 15 44,558,507 (GRCm38) critical splice acceptor site probably benign
RF006:Pkhd1l1 UTSW 15 44,503,238 (GRCm38) missense probably benign 0.03
RF008:Pkhd1l1 UTSW 15 44,558,505 (GRCm38) critical splice acceptor site probably benign
RF012:Pkhd1l1 UTSW 15 44,558,505 (GRCm38) critical splice acceptor site probably benign
RF019:Pkhd1l1 UTSW 15 44,558,507 (GRCm38) critical splice acceptor site probably benign
RF030:Pkhd1l1 UTSW 15 44,558,502 (GRCm38) critical splice acceptor site probably benign
RF033:Pkhd1l1 UTSW 15 44,558,506 (GRCm38) critical splice acceptor site probably benign
RF038:Pkhd1l1 UTSW 15 44,558,503 (GRCm38) critical splice acceptor site probably benign
RF046:Pkhd1l1 UTSW 15 44,558,495 (GRCm38) critical splice acceptor site probably benign
X0027:Pkhd1l1 UTSW 15 44,591,966 (GRCm38) missense probably damaging 0.99
Z1177:Pkhd1l1 UTSW 15 44,578,578 (GRCm38) missense probably damaging 0.99
Z1177:Pkhd1l1 UTSW 15 44,573,576 (GRCm38) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCACAGAGTACAATTTCAAGC -3'
(R):5'- GGATCTATCTGTTAGACTGGATGGC -3'

Sequencing Primer
(F):5'- GAGTACAATTTCAAGCAACTCAAAGG -3'
(R):5'- GATGGCTTTGAATTCATGTCCC -3'
Posted On 2018-03-15