Mutagenetix > Incidental Mutation

Incidental Mutation 'R6294:Smad2'

508648

Institutional Source

Beutler Lab

Gene Symbol

Smad2

Ensembl Gene

ENSMUSG00000024563

Gene Name

SMAD family member 2

Synonyms

Smad 2, Madr2, 7120426M23Rik, Madh2

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6294 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

76241580-76305731 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 76289162 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Asparagine to Isoleucine at position 215 (N215I)

Ref Sequence

ENSEMBL: ENSMUSP00000130115 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025453] [ENSMUST00000091831] [ENSMUST00000113930] [ENSMUST00000165084] [ENSMUST00000168423] [ENSMUST00000171256] [ENSMUST00000172198]

AlphaFold

Q62432

Predicted Effect

probably benign
Transcript: ENSMUST00000025453
AA Change: N215I

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000025453
Gene: ENSMUSG00000024563
AA Change: N215I

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWB	230	261	2e-10	BLAST
DWB	272	443	2.25e-108	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000091831
AA Change: N185I

PolyPhen 2 Score 0.153 (Sensitivity: 0.92; Specificity: 0.87)

SMART Domains

Protein: ENSMUSP00000089439
Gene: ENSMUSG00000024563
AA Change: N185I

Domain	Start	End	E-Value	Type
DWA	36	144	1.68e-66	SMART
Blast:DWB	200	231	1e-10	BLAST
DWB	242	413	2.25e-108	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000113930
AA Change: N185I

PolyPhen 2 Score 0.210 (Sensitivity: 0.92; Specificity: 0.88)

SMART Domains

Protein: ENSMUSP00000109563
Gene: ENSMUSG00000024563
AA Change: N185I

Domain	Start	End	E-Value	Type
DWA	36	144	1.68e-66	SMART
Blast:DWB	200	231	9e-11	BLAST
DWB	242	408	4.38e-88	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000165084

SMART Domains

Protein: ENSMUSP00000132851
Gene: ENSMUSG00000024563

Domain	Start	End	E-Value	Type
DWA	36	144	7.85e-67	SMART
PDB:1KHX\|A	166	204	3e-19	PDB
SCOP:d1khxa_	190	204	7e-4	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000168423
AA Change: N215I

PolyPhen 2 Score 0.309 (Sensitivity: 0.90; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000130115
Gene: ENSMUSG00000024563
AA Change: N215I

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWB	230	261	2e-10	BLAST
DWB	272	443	2.25e-108	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000171256
AA Change: N215I

PolyPhen 2 Score 0.297 (Sensitivity: 0.91; Specificity: 0.89)

SMART Domains

Protein: ENSMUSP00000125883
Gene: ENSMUSG00000024563
AA Change: N215I

Domain	Start	End	E-Value	Type
DWA	36	174	1e-64	SMART
Blast:DWA	182	213	3e-13	BLAST

Predicted Effect

probably benign
Transcript: ENSMUST00000172198

SMART Domains

Protein: ENSMUSP00000129232
Gene: ENSMUSG00000024563

Domain	Start	End	E-Value	Type
Pfam:MH2	28	58	1.8e-10	PFAM

Meta Mutation Damage Score

0.0835

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.6%
20x: 96.2%

Validation Efficiency

99% (71/72)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the SMAD, a family of proteins similar to the gene products of the Drosophila gene 'mothers against decapentaplegic' (Mad) and the C. elegans gene Sma. SMAD proteins are signal transducers and transcriptional modulators that mediate multiple signaling pathways. This protein mediates the signal of the transforming growth factor (TGF)-beta, and thus regulates multiple cellular processes, such as cell proliferation, apoptosis, and differentiation. This protein is recruited to the TGF-beta receptors through its interaction with the SMAD anchor for receptor activation (SARA) protein. In response to TGF-beta signal, this protein is phosphorylated by the TGF-beta receptors. The phosphorylation induces the dissociation of this protein with SARA and the association with the family member SMAD4. The association with SMAD4 is important for the translocation of this protein into the nucleus, where it binds to target promoters and forms a transcription repressor complex with other cofactors. This protein can also be phosphorylated by activin type 1 receptor kinase, and mediates the signal from the activin. Alternatively spliced transcript variants have been observed for this gene. [provided by RefSeq, May 2012]
PHENOTYPE: Homozygous mutant embryos die at day 6.5-8.5 with multiple defects, including failed gastrulation, lack of mesoderm, visceral endoderm dysfunction and failure to form anterior-posterior axis. Heterozygotes may show gastrulation defects and lack mandible or eyes. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 71 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A2m	A	T	6: 121,654,481	H579L	probably benign	Het
Aldh2	G	A	5: 121,572,816	Q8*	probably null	Het
Ankdd1a	G	T	9: 65,520,164	H10Q	probably benign	Het
Arpp21	A	G	9: 112,127,452	F453L	probably damaging	Het
Birc6	C	A	17: 74,689,257	D4461E	probably benign	Het
Cacna1b	A	T	2: 24,719,057	S411T	possibly damaging	Het
Camk2g	A	G	14: 20,764,949	I203T	probably damaging	Het
Cat	A	T	2: 103,460,295	C425S	probably benign	Het
Ccdc34	A	G	2: 110,018,151	D95G	probably benign	Het
Clca4b	T	C	3: 144,925,185	S305G	probably null	Het
Cul7	T	C	17: 46,663,148	I1453T	probably benign	Het
Dlg1	T	A	16: 31,838,124	I612N	probably damaging	Het
Dync2h1	T	G	9: 7,084,986	K561T	probably benign	Het
Erbin	T	C	13: 103,857,056	T359A	probably benign	Het
Far2	T	A	6: 148,157,482	L222Q	probably damaging	Het
Fbxw17	A	G	13: 50,423,803	E114G	probably benign	Het
Fryl	A	T	5: 73,191,759		probably benign	Het
Ggn	A	G	7: 29,173,848	D666G	possibly damaging	Het
Hal	G	A	10: 93,514,143		probably null	Het
Htt	A	G	5: 34,821,826	D851G	probably benign	Het
Ighv14-2	A	T	12: 113,994,598	D74E	probably benign	Het
Igkv5-43	G	A	6: 69,823,442	S87L	probably damaging	Het
Klhl29	A	T	12: 5,083,995	F720I	probably damaging	Het
Klk1b8	T	A	7: 43,952,772	Y43N	probably damaging	Het
Krtap6-3	T	A	16: 89,084,101	Y7N	unknown	Het
Lama4	T	A	10: 39,075,470	F1070L	probably damaging	Het
Map4	A	G	9: 110,002,746	E98G	possibly damaging	Het
Mbtd1	C	T	11: 93,932,232	H493Y	possibly damaging	Het
Mki67	A	G	7: 135,704,590	M581T	probably benign	Het
Mtss1l	T	A	8: 110,727,328	N43K	possibly damaging	Het
Mylk3	T	A	8: 85,350,383	I475F	probably damaging	Het
Nat14	C	T	7: 4,924,074	R82*	probably null	Het
Nckap1	T	C	2: 80,541,514	N324S	probably benign	Het
Nemp1	C	T	10: 127,694,522	T281M	possibly damaging	Het
Nrg3	A	T	14: 38,397,239	H425Q	probably benign	Het
Olfr101	T	A	17: 37,299,553	T290S	probably benign	Het
Olfr1318	A	G	2: 112,156,019	I23V	probably benign	Het
Olfr1487	T	C	19: 13,619,366	V25A	probably benign	Het
Olfr584	A	T	7: 103,085,667	I45F	probably benign	Het
Olfr622	A	G	7: 103,639,591	M183T	probably damaging	Het
Olfr95	T	C	17: 37,211,626	T76A	probably benign	Het
Omd	T	A	13: 49,589,991	N172K	probably damaging	Het
Orc1	T	C	4: 108,590,670	I38T	probably benign	Het
Oxct1	A	G	15: 4,142,822	T457A	possibly damaging	Het
Pcdh17	A	T	14: 84,477,668	K924N	probably benign	Het
Pkhd1l1	A	T	15: 44,570,028	I3435F	probably damaging	Het
Psg20	C	A	7: 18,682,679	V171F	probably damaging	Het
Rab11fip2	A	T	19: 59,937,099	S87T	probably damaging	Het
Rabgap1l	T	C	1: 160,231,849	T237A	probably benign	Het
Rasgrp1	A	T	2: 117,291,792	Y372*	probably null	Het
Rell1	G	T	5: 63,939,705		probably benign	Het
Rps14	A	G	18: 60,776,961	K61E	possibly damaging	Het
Rtl6	A	G	15: 84,557,120	V25A	possibly damaging	Het
Ryr2	G	T	13: 11,879,496	S185R	probably damaging	Het
Slc10a2	C	T	8: 5,091,621		probably null	Het
Slc14a1	T	A	18: 78,110,058		probably null	Het
Smchd1	A	T	17: 71,370,927	N1473K	probably benign	Het
Spag9	A	G	11: 94,093,485		probably null	Het
Stk31	A	C	6: 49,417,344	R213S	probably benign	Het
Tmod4	A	T	3: 95,128,306	Q255L	probably benign	Het
Tnpo1	T	A	13: 98,890,774	Y3F	probably benign	Het
Tom1l1	A	C	11: 90,661,761	Y206*	probably null	Het
Tulp2	A	G	7: 45,514,692	K36E	probably damaging	Het
Tulp4	C	T	17: 6,201,819	R282C	probably damaging	Het
Unc5b	A	T	10: 60,778,331	N246K	possibly damaging	Het
Ush2a	C	G	1: 188,536,370	S1674R	possibly damaging	Het
Vmn1r224	T	C	17: 20,419,821	I220T	probably benign	Het
Vmn1r7	G	C	6: 57,024,419	N285K	probably benign	Het
Vmn2r83	C	T	10: 79,477,854	P99S	probably damaging	Het
Zbtb38	A	G	9: 96,687,229	F601L	probably benign	Het
Zc3h3	A	T	15: 75,809,568	S555T	possibly damaging	Het

Other mutations in Smad2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00429:Smad2	APN	18	76298495	missense	possibly damaging	0.94
IGL00978:Smad2	APN	18	76299775	splice site	probably benign
IGL01295:Smad2	APN	18	76302430	missense	probably benign	0.05
IGL01887:Smad2	APN	18	76299894	missense	probably damaging	1.00
IGL01960:Smad2	APN	18	76262484	intron	probably benign
IGL02881:Smad2	APN	18	76299780	splice site	probably null
IGL02977:Smad2	APN	18	76289164	missense	possibly damaging	0.64
R0333:Smad2	UTSW	18	76262621	missense	probably damaging	1.00
R0391:Smad2	UTSW	18	76289037	critical splice acceptor site	probably null
R0523:Smad2	UTSW	18	76262552	missense	probably benign
R0570:Smad2	UTSW	18	76289179	splice site	probably benign
R0624:Smad2	UTSW	18	76299993	missense	probably damaging	1.00
R1573:Smad2	UTSW	18	76262586	missense	possibly damaging	0.89
R1953:Smad2	UTSW	18	76262705	missense	possibly damaging	0.90
R2132:Smad2	UTSW	18	76288084	nonsense	probably null
R2213:Smad2	UTSW	18	76304626	missense	probably damaging	1.00
R3021:Smad2	UTSW	18	76262632	missense	probably damaging	1.00
R3917:Smad2	UTSW	18	76287937	missense	probably benign	0.42
R4503:Smad2	UTSW	18	76302592	missense	probably benign	0.23
R5253:Smad2	UTSW	18	76288053	missense	probably damaging	1.00
R5290:Smad2	UTSW	18	76262724	missense	probably damaging	1.00
R5891:Smad2	UTSW	18	76299975	missense	probably damaging	1.00
R6879:Smad2	UTSW	18	76262654	missense	possibly damaging	0.49
R7430:Smad2	UTSW	18	76288080	missense	probably damaging	1.00
R7503:Smad2	UTSW	18	76286885	missense	probably benign
R7757:Smad2	UTSW	18	76288013	missense	probably benign	0.40
R8072:Smad2	UTSW	18	76286951	critical splice donor site	probably null
R9132:Smad2	UTSW	18	76262502	missense	possibly damaging	0.87
R9159:Smad2	UTSW	18	76262502	missense	possibly damaging	0.87
R9184:Smad2	UTSW	18	76289100	missense	probably benign	0.00
Z1177:Smad2	UTSW	18	76288002	missense	probably damaging	1.00
Z1177:Smad2	UTSW	18	76288003	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAAGGCCTTTCCGTAACCCC -3'
(R):5'- AGCTGTCTCTACTTCAAGAGC -3'

Sequencing Primer
(F):5'- AACCCCTTCTGCCACTAACTTGG -3'
(R):5'- GCTGTCTCTACTTCAAGAGCTTTAAC -3'

Posted On

2018-03-15