Incidental Mutation 'R6083:Efnb2'
ID508655
Institutional Source Beutler Lab
Gene Symbol Efnb2
Ensembl Gene ENSMUSG00000001300
Gene Nameephrin B2
SynonymsLERK-5, Epl5, Htk-L, ELF-2, NLERK-1, Eplg5, Lerk5
MMRRC Submission 044242-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6083 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location8617434-8661242 bp(-) (GRCm38)
Type of Mutationsplice site (3 bp from exon)
DNA Base Change (assembly) T to C at 8622328 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000001319]
Predicted Effect probably null
Transcript: ENSMUST00000001319
SMART Domains Protein: ENSMUSP00000001319
Gene: ENSMUSG00000001300

DomainStartEndE-ValueType
Pfam:Ephrin 32 167 4.6e-53 PFAM
transmembrane domain 231 253 N/A INTRINSIC
low complexity region 267 277 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000152698
SMART Domains Protein: ENSMUSP00000116027
Gene: ENSMUSG00000001300

DomainStartEndE-ValueType
Pfam:Ephrin 1 68 1.3e-19 PFAM
transmembrane domain 115 137 N/A INTRINSIC
low complexity region 151 161 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ephrin (EPH) family. The ephrins and EPH-related receptors comprise the largest subfamily of receptor protein-tyrosine kinases and have been implicated in mediating developmental events, especially in the nervous system and in erythropoiesis. Based on their structures and sequence relationships, ephrins are divided into the ephrin-A (EFNA) class, which are anchored to the membrane by a glycosylphosphatidylinositol linkage, and the ephrin-B (EFNB) class, which are transmembrane proteins. This gene encodes an EFNB class ephrin which binds to the EPHB4 and EPHA3 receptors. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit defects in angiogenesis of both arteries and veins and die by embryonic day 11.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C A 11: 58,878,851 P73Q possibly damaging Het
Aak1 A T 6: 86,963,996 I591F unknown Het
Ace C A 11: 105,985,267 Y816* probably null Het
Ahnak2 A G 12: 112,782,612 V1205A probably benign Het
Ahnak2 T G 12: 112,782,999 Q1076P probably benign Het
Ap2a1 G A 7: 44,907,751 R263W probably damaging Het
Arhgap29 A G 3: 121,992,748 T257A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Ccdc17 A T 4: 116,596,926 Q47L possibly damaging Het
Cep170 C T 1: 176,774,625 R305H probably damaging Het
Cyb5r4 C T 9: 87,057,168 P335S probably damaging Het
Cyp2c54 A G 19: 40,073,762 L17P probably benign Het
Cyp2c69 A T 19: 39,849,456 V394E probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Defb36 A T 2: 152,604,488 M1L unknown Het
Dnaja1 A G 4: 40,731,713 D263G probably benign Het
Dock10 T C 1: 80,532,431 N1560S probably damaging Het
Eif3e A G 15: 43,266,144 I196T probably damaging Het
Ercc4 T A 16: 13,110,039 C24* probably null Het
Fmn1 A G 2: 113,364,303 E116G unknown Het
Gnas A G 2: 174,297,862 M1V probably null Het
Grin2a C A 16: 9,579,540 M894I probably benign Het
Herc2 G T 7: 56,228,505 S4566I probably benign Het
Hmcn1 G A 1: 150,755,293 P918L probably damaging Het
Hmcn1 G T 1: 150,755,294 P918T probably damaging Het
Hsd3b2 T A 3: 98,712,056 Y191F possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Itih2 T C 2: 10,108,894 probably benign Het
Itsn1 T C 16: 91,853,011 L191P probably benign Het
Kdr T C 5: 75,944,366 K1068R probably damaging Het
Lmtk2 T C 5: 144,182,756 L1345P probably damaging Het
Man2b2 T A 5: 36,809,041 D936V probably damaging Het
Mapk1ip1 G A 7: 138,836,588 R38* probably null Het
Med13l T C 5: 118,721,486 V246A possibly damaging Het
Mlec T A 5: 115,148,049 T248S probably benign Het
Mslnl T A 17: 25,737,902 V54D possibly damaging Het
Muc16 G A 9: 18,657,212 T1337I unknown Het
Nek7 C T 1: 138,515,654 S187N probably damaging Het
Neto2 A G 8: 85,640,585 V538A probably benign Het
Nktr T C 9: 121,750,136 probably benign Het
Npy6r A G 18: 44,276,492 K327E probably damaging Het
Olfr1230 T A 2: 89,297,024 D82V probably damaging Het
Olfr1245 T C 2: 89,575,672 D18G probably benign Het
Olfr1463 A T 19: 13,234,525 I92F probably benign Het
Olfr402 A G 11: 74,155,570 M139V possibly damaging Het
Olfr705 A G 7: 106,873,582 I221T probably damaging Het
Pcdhga4 A T 18: 37,687,425 N676Y probably damaging Het
Pde2a T C 7: 101,502,879 I331T possibly damaging Het
Pip5k1b A T 19: 24,304,035 Y486* probably null Het
Plch2 A G 4: 155,000,818 M272T probably benign Het
Rbm12 G A 2: 156,097,726 probably benign Het
Rgs19 T C 2: 181,689,507 E111G probably damaging Het
Rhbdf1 T C 11: 32,210,066 N145S probably damaging Het
Rnf4 T A 5: 34,351,221 probably null Het
Rpa1 T C 11: 75,314,911 T207A probably damaging Het
Rufy4 A C 1: 74,129,397 Q113P probably damaging Het
Sh3pxd2b T G 11: 32,422,985 S717R probably benign Het
Sin3a A T 9: 57,107,540 I682F probably damaging Het
Sipa1l2 A T 8: 125,468,473 V842E possibly damaging Het
Slc5a4a A G 10: 76,147,597 I23V unknown Het
Slitrk5 A G 14: 111,681,725 N927S probably benign Het
Smc6 A G 12: 11,276,353 K117R possibly damaging Het
Sod2 G A 17: 13,008,031 probably benign Het
Stxbp1 A G 2: 32,796,018 I567T possibly damaging Het
Tbkbp1 C A 11: 97,147,380 L209F probably damaging Het
Tll1 G T 8: 64,038,586 probably null Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Trim30b A G 7: 104,366,142 V13A probably damaging Het
Trip11 G A 12: 101,889,742 T425I probably benign Het
Ttn C A 2: 76,889,973 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ush2a T A 1: 188,267,023 S177T probably damaging Het
Usp40 A T 1: 87,978,559 S651R probably benign Het
Vmn1r125 T C 7: 21,272,719 S181P probably damaging Het
Vmn1r198 T A 13: 22,354,758 V138D possibly damaging Het
Vmn1r56 A G 7: 5,196,318 L100P probably damaging Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r53 A C 7: 12,581,881 H670Q probably benign Het
Vmn2r69 A T 7: 85,406,503 I809N probably damaging Het
Wdr7 G A 18: 63,728,469 G184D probably damaging Het
Wnk1 C T 6: 120,037,601 G11D probably damaging Het
Zfp110 A C 7: 12,844,675 E171A possibly damaging Het
Zkscan6 T C 11: 65,815,931 V134A probably damaging Het
Other mutations in Efnb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Efnb2 APN 8 8660589 missense probably benign 0.08
IGL02076:Efnb2 APN 8 8660488 missense probably benign
IGL03333:Efnb2 APN 8 8639275 nonsense probably null
IGL03098:Efnb2 UTSW 8 8663420 unclassified probably benign
R1416:Efnb2 UTSW 8 8622329 critical splice donor site probably null
R1760:Efnb2 UTSW 8 8623184 missense possibly damaging 0.90
R1783:Efnb2 UTSW 8 8623237 missense probably damaging 1.00
R4272:Efnb2 UTSW 8 8620698 missense probably damaging 0.99
R4398:Efnb2 UTSW 8 8620832 missense possibly damaging 0.80
R4782:Efnb2 UTSW 8 8623104 intron probably null
R4799:Efnb2 UTSW 8 8623104 intron probably null
R5193:Efnb2 UTSW 8 8623162 missense probably damaging 1.00
R5443:Efnb2 UTSW 8 8620862 missense probably damaging 1.00
R5749:Efnb2 UTSW 8 8639347 missense probably damaging 1.00
R6266:Efnb2 UTSW 8 8660524 missense probably benign
R6482:Efnb2 UTSW 8 8620637 missense probably damaging 1.00
R7371:Efnb2 UTSW 8 8660524 missense probably benign
Z1177:Efnb2 UTSW 8 8623147 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACTTCTGGCGAGCTCTGTTAC -3'
(R):5'- GAGATATGTGTGCAGCTCTGAAG -3'

Posted On2018-03-16