Mutagenetix > Incidental Mutations

Incidental Mutation 'R6083:Tll1'

508656

Institutional Source

Beutler Lab

Gene Symbol

Tll1

Ensembl Gene

ENSMUSG00000053626

Gene Name

tolloid-like

Synonyms

Tll-1

MMRRC Submission

044242-MU

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6083 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

64014931-64206271 bp(-) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

G to T at 64038586 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000070560 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000066166]

AlphaFold

no structure available at present

Predicted Effect

probably null
Transcript: ENSMUST00000066166

SMART Domains

Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626

Domain	Start	End	E-Value	Type
ZnMc	153	295	4.12e-56	SMART
CUB	349	461	4.12e-44	SMART
CUB	462	574	3.81e-48	SMART
EGF_CA	574	615	2.28e-9	SMART
CUB	618	730	9.11e-46	SMART
EGF_CA	730	770	4.25e-9	SMART
CUB	774	886	2.01e-47	SMART
CUB	887	1003	7.19e-35	SMART

Meta Mutation Damage Score

0.9755

Coding Region Coverage

1x: 99.9%
3x: 99.7%
10x: 98.4%
20x: 95.6%

Validation Efficiency

96% (76/79)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 84 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2810021J22Rik	C	A	11: 58,878,851	P73Q	possibly damaging	Het
Aak1	A	T	6: 86,963,996	I591F	unknown	Het
Ace	C	A	11: 105,985,267	Y816*	probably null	Het
Ahnak2	A	G	12: 112,782,612	V1205A	probably benign	Het
Ahnak2	T	G	12: 112,782,999	Q1076P	probably benign	Het
Ap2a1	G	A	7: 44,907,751	R263W	probably damaging	Het
Arhgap29	A	G	3: 121,992,748	T257A	probably benign	Het
Bora	A	T	14: 99,062,294	Q234L	possibly damaging	Het
Ccdc17	A	T	4: 116,596,926	Q47L	possibly damaging	Het
Cep170	C	T	1: 176,774,625	R305H	probably damaging	Het
Cyb5r4	C	T	9: 87,057,168	P335S	probably damaging	Het
Cyp2c54	A	G	19: 40,073,762	L17P	probably benign	Het
Cyp2c69	A	T	19: 39,849,456	V394E	probably damaging	Het
Dedd2	G	A	7: 25,211,290	P154S	probably benign	Het
Defb36	A	T	2: 152,604,488	M1L	unknown	Het
Dnaja1	A	G	4: 40,731,713	D263G	probably benign	Het
Dock10	T	C	1: 80,532,431	N1560S	probably damaging	Het
Efnb2	T	C	8: 8,622,328		probably null	Het
Eif3e	A	G	15: 43,266,144	I196T	probably damaging	Het
Ercc4	T	A	16: 13,110,039	C24*	probably null	Het
Fmn1	A	G	2: 113,364,303	E116G	unknown	Het
Gnas	A	G	2: 174,297,862	M1V	probably null	Het
Grin2a	C	A	16: 9,579,540	M894I	probably benign	Het
Herc2	G	T	7: 56,228,505	S4566I	probably benign	Het
Hmcn1	G	A	1: 150,755,293	P918L	probably damaging	Het
Hmcn1	G	T	1: 150,755,294	P918T	probably damaging	Het
Hsd3b2	T	A	3: 98,712,056	Y191F	possibly damaging	Het
Ifit1bl2	A	C	19: 34,619,817	F133C	possibly damaging	Het
Itih2	T	C	2: 10,108,894		probably benign	Het
Itsn1	T	C	16: 91,853,011	L191P	probably benign	Het
Kdr	T	C	5: 75,944,366	K1068R	probably damaging	Het
Lmtk2	T	C	5: 144,182,756	L1345P	probably damaging	Het
Man2b2	T	A	5: 36,809,041	D936V	probably damaging	Het
Mapk1ip1	G	A	7: 138,836,588	R38*	probably null	Het
Med13l	T	C	5: 118,721,486	V246A	possibly damaging	Het
Mlec	T	A	5: 115,148,049	T248S	probably benign	Het
Mslnl	T	A	17: 25,737,902	V54D	possibly damaging	Het
Muc16	G	A	9: 18,657,212	T1337I	unknown	Het
Nek7	C	T	1: 138,515,654	S187N	probably damaging	Het
Neto2	A	G	8: 85,640,585	V538A	probably benign	Het
Nktr	T	C	9: 121,750,136		probably benign	Het
Npy6r	A	G	18: 44,276,492	K327E	probably damaging	Het
Olfr1230	T	A	2: 89,297,024	D82V	probably damaging	Het
Olfr1245	T	C	2: 89,575,672	D18G	probably benign	Het
Olfr1463	A	T	19: 13,234,525	I92F	probably benign	Het
Olfr402	A	G	11: 74,155,570	M139V	possibly damaging	Het
Olfr705	A	G	7: 106,873,582	I221T	probably damaging	Het
Pcdhga4	A	T	18: 37,687,425	N676Y	probably damaging	Het
Pde2a	T	C	7: 101,502,879	I331T	possibly damaging	Het
Pip5k1b	A	T	19: 24,304,035	Y486*	probably null	Het
Plch2	A	G	4: 155,000,818	M272T	probably benign	Het
Rbm12	G	A	2: 156,097,726		probably benign	Het
Rgs19	T	C	2: 181,689,507	E111G	probably damaging	Het
Rhbdf1	T	C	11: 32,210,066	N145S	probably damaging	Het
Rnf4	T	A	5: 34,351,221		probably null	Het
Rpa1	T	C	11: 75,314,911	T207A	probably damaging	Het
Rufy4	A	C	1: 74,129,397	Q113P	probably damaging	Het
Sh3pxd2b	T	G	11: 32,422,985	S717R	probably benign	Het
Sin3a	A	T	9: 57,107,540	I682F	probably damaging	Het
Sipa1l2	A	T	8: 125,468,473	V842E	possibly damaging	Het
Slc5a4a	A	G	10: 76,147,597	I23V	unknown	Het
Slitrk5	A	G	14: 111,681,725	N927S	probably benign	Het
Smc6	A	G	12: 11,276,353	K117R	possibly damaging	Het
Sod2	G	A	17: 13,008,031		probably benign	Het
Stxbp1	A	G	2: 32,796,018	I567T	possibly damaging	Het
Tbkbp1	C	A	11: 97,147,380	L209F	probably damaging	Het
Tmem38b	T	C	4: 53,840,765	L60S	probably damaging	Het
Trib1	G	A	15: 59,654,475	R298H	probably damaging	Het
Trim30b	A	G	7: 104,366,142	V13A	probably damaging	Het
Trip11	G	A	12: 101,889,742	T425I	probably benign	Het
Ttn	C	A	2: 76,889,973		probably benign	Het
Tymp	GC	GCC	15: 89,374,364		probably null	Het
Ush2a	T	A	1: 188,267,023	S177T	probably damaging	Het
Usp40	A	T	1: 87,978,559	S651R	probably benign	Het
Vmn1r125	T	C	7: 21,272,719	S181P	probably damaging	Het
Vmn1r198	T	A	13: 22,354,758	V138D	possibly damaging	Het
Vmn1r56	A	G	7: 5,196,318	L100P	probably damaging	Het
Vmn2r32	T	A	7: 7,464,210	D773V	probably benign	Het
Vmn2r53	A	C	7: 12,581,881	H670Q	probably benign	Het
Vmn2r69	A	T	7: 85,406,503	I809N	probably damaging	Het
Wdr7	G	A	18: 63,728,469	G184D	probably damaging	Het
Wnk1	C	T	6: 120,037,601	G11D	probably damaging	Het
Zfp110	A	C	7: 12,844,675	E171A	possibly damaging	Het
Zkscan6	T	C	11: 65,815,931	V134A	probably damaging	Het

Other mutations in Tll1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00163:Tll1	APN	8	64016136	missense	probably benign
IGL00583:Tll1	APN	8	64205292	missense	probably benign
IGL00767:Tll1	APN	8	64071321	missense	probably damaging	1.00
IGL01061:Tll1	APN	8	64038454	critical splice donor site	probably null
IGL01077:Tll1	APN	8	64070232	missense	probably benign	0.27
IGL01536:Tll1	APN	8	64074289	missense	probably damaging	1.00
IGL02137:Tll1	APN	8	64016098	missense	possibly damaging	0.73
IGL02168:Tll1	APN	8	64053967	missense	possibly damaging	0.50
IGL02378:Tll1	APN	8	64017626	nonsense	probably null
IGL02469:Tll1	APN	8	64070280	missense	probably benign	0.41
IGL02504:Tll1	APN	8	64070237	missense	possibly damaging	0.55
IGL02650:Tll1	APN	8	64046997	splice site	probably benign
IGL02937:Tll1	APN	8	64205285	nonsense	probably null
IGL03006:Tll1	APN	8	64074217	splice site	probably benign
R0518:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0521:Tll1	UTSW	8	64098471	missense	probably damaging	1.00
R0541:Tll1	UTSW	8	64038452	splice site	probably null
R0612:Tll1	UTSW	8	64071310	missense	possibly damaging	0.91
R0690:Tll1	UTSW	8	64074290	missense	probably damaging	0.99
R0738:Tll1	UTSW	8	64101950	missense	probably damaging	1.00
R1454:Tll1	UTSW	8	64038490	missense	probably benign
R1619:Tll1	UTSW	8	64056273	missense	probably benign	0.25
R1625:Tll1	UTSW	8	64041442	missense	probably damaging	1.00
R1654:Tll1	UTSW	8	64117903	critical splice donor site	probably null
R1663:Tll1	UTSW	8	64017686	missense	probably benign	0.08
R1681:Tll1	UTSW	8	64085551	missense	possibly damaging	0.93
R1713:Tll1	UTSW	8	64101873	missense	probably damaging	0.99
R1908:Tll1	UTSW	8	64025107	missense	probably damaging	0.98
R2118:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2121:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2124:Tll1	UTSW	8	64085557	missense	probably benign	0.21
R2360:Tll1	UTSW	8	64051401	missense	probably damaging	1.00
R2396:Tll1	UTSW	8	64070290	nonsense	probably null
R3032:Tll1	UTSW	8	64098492	missense	probably damaging	0.96
R3115:Tll1	UTSW	8	64053866	missense	probably damaging	1.00
R3889:Tll1	UTSW	8	64205224	missense	possibly damaging	0.77
R4126:Tll1	UTSW	8	64118014	missense	possibly damaging	0.78
R4182:Tll1	UTSW	8	64041511	missense	probably damaging	1.00
R4572:Tll1	UTSW	8	64056309	missense	possibly damaging	0.81
R4677:Tll1	UTSW	8	64051377	missense	probably benign	0.31
R4811:Tll1	UTSW	8	64085473	missense	possibly damaging	0.72
R4904:Tll1	UTSW	8	64070199	missense	probably benign	0.00
R4992:Tll1	UTSW	8	64093944	missense	probably damaging	0.98
R5061:Tll1	UTSW	8	64053949	missense	probably damaging	0.99
R5078:Tll1	UTSW	8	64093887	missense	probably damaging	1.00
R5208:Tll1	UTSW	8	64051493	missense	probably damaging	0.99
R5283:Tll1	UTSW	8	64101966	missense	possibly damaging	0.68
R5399:Tll1	UTSW	8	64085488	missense	probably damaging	1.00
R5699:Tll1	UTSW	8	64117940	missense	probably damaging	0.98
R5986:Tll1	UTSW	8	64074263	missense	probably damaging	0.99
R6019:Tll1	UTSW	8	64041491	missense	possibly damaging	0.83
R6046:Tll1	UTSW	8	64053891	nonsense	probably null
R6125:Tll1	UTSW	8	64051487	missense	probably damaging	1.00
R6222:Tll1	UTSW	8	64098534	missense	probably benign	0.18
R6275:Tll1	UTSW	8	64051367	nonsense	probably null
R6508:Tll1	UTSW	8	64098460	missense	probably damaging	0.99
R6758:Tll1	UTSW	8	64041405	critical splice donor site	probably null
R6782:Tll1	UTSW	8	64071281	missense	probably benign	0.00
R6848:Tll1	UTSW	8	64098510	missense	probably damaging	0.99
R7057:Tll1	UTSW	8	64101881	missense	probably damaging	1.00
R7144:Tll1	UTSW	8	64124945	missense	possibly damaging	0.90
R7244:Tll1	UTSW	8	64025188	missense	probably benign	0.00
R7336:Tll1	UTSW	8	64025142	missense	probably damaging	0.98
R7373:Tll1	UTSW	8	64051357	missense	probably damaging	0.98
R7626:Tll1	UTSW	8	64098234	splice site	probably null
R7687:Tll1	UTSW	8	64121492	nonsense	probably null
R7699:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7700:Tll1	UTSW	8	64093954	missense	probably benign	0.00
R7765:Tll1	UTSW	8	64051449	missense	probably damaging	1.00
R7790:Tll1	UTSW	8	64025237	nonsense	probably null
R7954:Tll1	UTSW	8	64118534	missense	probably damaging	1.00
R8710:Tll1	UTSW	8	64124906	missense	possibly damaging	0.77
R8792:Tll1	UTSW	8	64085465	missense	probably damaging	1.00
R9134:Tll1	UTSW	8	64016167	missense	possibly damaging	0.91
R9444:Tll1	UTSW	8	64016089	missense	probably damaging	1.00
X0020:Tll1	UTSW	8	64017628	missense	probably damaging	0.97
Z1176:Tll1	UTSW	8	64047163	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTGTGGGTTAGCCAAGAAAG -3'
(R):5'- TTGCCAGCATTTCAGACTACAAAC -3'

Posted On

2018-03-16