Incidental Mutation 'R6083:Tll1'
ID 508656
Institutional Source Beutler Lab
Gene Symbol Tll1
Ensembl Gene ENSMUSG00000053626
Gene Name tolloid-like
Synonyms Tll-1
MMRRC Submission 044242-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R6083 (G1)
Quality Score 225.009
Status Validated
Chromosome 8
Chromosomal Location 64014931-64206271 bp(-) (GRCm38)
Type of Mutation splice site
DNA Base Change (assembly) G to T at 64038586 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000070560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066166]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000066166
SMART Domains Protein: ENSMUSP00000070560
Gene: ENSMUSG00000053626

DomainStartEndE-ValueType
ZnMc 153 295 4.12e-56 SMART
CUB 349 461 4.12e-44 SMART
CUB 462 574 3.81e-48 SMART
EGF_CA 574 615 2.28e-9 SMART
CUB 618 730 9.11e-46 SMART
EGF_CA 730 770 4.25e-9 SMART
CUB 774 886 2.01e-47 SMART
CUB 887 1003 7.19e-35 SMART
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.4%
  • 20x: 95.6%
Validation Efficiency 96% (76/79)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an astacin-like, zinc-dependent, metalloprotease that belongs to the peptidase M12A family. This protease processes procollagen C-propeptides, such as chordin, pro-biglycan and pro-lysyl oxidase. Studies in mice suggest that this gene plays multiple roles in the development of mammalian heart, and is essential for the formation of the interventricular septum. Allelic variants of this gene are associated with atrial septal defect type 6. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Mar 2011]
PHENOTYPE: Homozygous null mice are embryonic lethal with death at midgestation from cardiac failure. Cardiac defects include incomplete formation of the ventricular septum and abnormal positioning of the heart and aorta. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 84 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810021J22Rik C A 11: 58,878,851 P73Q possibly damaging Het
Aak1 A T 6: 86,963,996 I591F unknown Het
Ace C A 11: 105,985,267 Y816* probably null Het
Ahnak2 A G 12: 112,782,612 V1205A probably benign Het
Ahnak2 T G 12: 112,782,999 Q1076P probably benign Het
Ap2a1 G A 7: 44,907,751 R263W probably damaging Het
Arhgap29 A G 3: 121,992,748 T257A probably benign Het
Bora A T 14: 99,062,294 Q234L possibly damaging Het
Ccdc17 A T 4: 116,596,926 Q47L possibly damaging Het
Cep170 C T 1: 176,774,625 R305H probably damaging Het
Cyb5r4 C T 9: 87,057,168 P335S probably damaging Het
Cyp2c54 A G 19: 40,073,762 L17P probably benign Het
Cyp2c69 A T 19: 39,849,456 V394E probably damaging Het
Dedd2 G A 7: 25,211,290 P154S probably benign Het
Defb36 A T 2: 152,604,488 M1L unknown Het
Dnaja1 A G 4: 40,731,713 D263G probably benign Het
Dock10 T C 1: 80,532,431 N1560S probably damaging Het
Efnb2 T C 8: 8,622,328 probably null Het
Eif3e A G 15: 43,266,144 I196T probably damaging Het
Ercc4 T A 16: 13,110,039 C24* probably null Het
Fmn1 A G 2: 113,364,303 E116G unknown Het
Gnas A G 2: 174,297,862 M1V probably null Het
Grin2a C A 16: 9,579,540 M894I probably benign Het
Herc2 G T 7: 56,228,505 S4566I probably benign Het
Hmcn1 G A 1: 150,755,293 P918L probably damaging Het
Hmcn1 G T 1: 150,755,294 P918T probably damaging Het
Hsd3b2 T A 3: 98,712,056 Y191F possibly damaging Het
Ifit1bl2 A C 19: 34,619,817 F133C possibly damaging Het
Itih2 T C 2: 10,108,894 probably benign Het
Itsn1 T C 16: 91,853,011 L191P probably benign Het
Kdr T C 5: 75,944,366 K1068R probably damaging Het
Lmtk2 T C 5: 144,182,756 L1345P probably damaging Het
Man2b2 T A 5: 36,809,041 D936V probably damaging Het
Mapk1ip1 G A 7: 138,836,588 R38* probably null Het
Med13l T C 5: 118,721,486 V246A possibly damaging Het
Mlec T A 5: 115,148,049 T248S probably benign Het
Mslnl T A 17: 25,737,902 V54D possibly damaging Het
Muc16 G A 9: 18,657,212 T1337I unknown Het
Nek7 C T 1: 138,515,654 S187N probably damaging Het
Neto2 A G 8: 85,640,585 V538A probably benign Het
Nktr T C 9: 121,750,136 probably benign Het
Npy6r A G 18: 44,276,492 K327E probably damaging Het
Olfr1230 T A 2: 89,297,024 D82V probably damaging Het
Olfr1245 T C 2: 89,575,672 D18G probably benign Het
Olfr1463 A T 19: 13,234,525 I92F probably benign Het
Olfr402 A G 11: 74,155,570 M139V possibly damaging Het
Olfr705 A G 7: 106,873,582 I221T probably damaging Het
Pcdhga4 A T 18: 37,687,425 N676Y probably damaging Het
Pde2a T C 7: 101,502,879 I331T possibly damaging Het
Pip5k1b A T 19: 24,304,035 Y486* probably null Het
Plch2 A G 4: 155,000,818 M272T probably benign Het
Rbm12 G A 2: 156,097,726 probably benign Het
Rgs19 T C 2: 181,689,507 E111G probably damaging Het
Rhbdf1 T C 11: 32,210,066 N145S probably damaging Het
Rnf4 T A 5: 34,351,221 probably null Het
Rpa1 T C 11: 75,314,911 T207A probably damaging Het
Rufy4 A C 1: 74,129,397 Q113P probably damaging Het
Sh3pxd2b T G 11: 32,422,985 S717R probably benign Het
Sin3a A T 9: 57,107,540 I682F probably damaging Het
Sipa1l2 A T 8: 125,468,473 V842E possibly damaging Het
Slc5a4a A G 10: 76,147,597 I23V unknown Het
Slitrk5 A G 14: 111,681,725 N927S probably benign Het
Smc6 A G 12: 11,276,353 K117R possibly damaging Het
Sod2 G A 17: 13,008,031 probably benign Het
Stxbp1 A G 2: 32,796,018 I567T possibly damaging Het
Tbkbp1 C A 11: 97,147,380 L209F probably damaging Het
Tmem38b T C 4: 53,840,765 L60S probably damaging Het
Trib1 G A 15: 59,654,475 R298H probably damaging Het
Trim30b A G 7: 104,366,142 V13A probably damaging Het
Trip11 G A 12: 101,889,742 T425I probably benign Het
Ttn C A 2: 76,889,973 probably benign Het
Tymp GC GCC 15: 89,374,364 probably null Het
Ush2a T A 1: 188,267,023 S177T probably damaging Het
Usp40 A T 1: 87,978,559 S651R probably benign Het
Vmn1r125 T C 7: 21,272,719 S181P probably damaging Het
Vmn1r198 T A 13: 22,354,758 V138D possibly damaging Het
Vmn1r56 A G 7: 5,196,318 L100P probably damaging Het
Vmn2r32 T A 7: 7,464,210 D773V probably benign Het
Vmn2r53 A C 7: 12,581,881 H670Q probably benign Het
Vmn2r69 A T 7: 85,406,503 I809N probably damaging Het
Wdr7 G A 18: 63,728,469 G184D probably damaging Het
Wnk1 C T 6: 120,037,601 G11D probably damaging Het
Zfp110 A C 7: 12,844,675 E171A possibly damaging Het
Zkscan6 T C 11: 65,815,931 V134A probably damaging Het
Other mutations in Tll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Tll1 APN 8 64016136 missense probably benign
IGL00583:Tll1 APN 8 64205292 missense probably benign
IGL00767:Tll1 APN 8 64071321 missense probably damaging 1.00
IGL01061:Tll1 APN 8 64038454 critical splice donor site probably null
IGL01077:Tll1 APN 8 64070232 missense probably benign 0.27
IGL01536:Tll1 APN 8 64074289 missense probably damaging 1.00
IGL02137:Tll1 APN 8 64016098 missense possibly damaging 0.73
IGL02168:Tll1 APN 8 64053967 missense possibly damaging 0.50
IGL02378:Tll1 APN 8 64017626 nonsense probably null
IGL02469:Tll1 APN 8 64070280 missense probably benign 0.41
IGL02504:Tll1 APN 8 64070237 missense possibly damaging 0.55
IGL02650:Tll1 APN 8 64046997 splice site probably benign
IGL02937:Tll1 APN 8 64205285 nonsense probably null
IGL03006:Tll1 APN 8 64074217 splice site probably benign
R0518:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0521:Tll1 UTSW 8 64098471 missense probably damaging 1.00
R0541:Tll1 UTSW 8 64038452 splice site probably null
R0612:Tll1 UTSW 8 64071310 missense possibly damaging 0.91
R0690:Tll1 UTSW 8 64074290 missense probably damaging 0.99
R0738:Tll1 UTSW 8 64101950 missense probably damaging 1.00
R1454:Tll1 UTSW 8 64038490 missense probably benign
R1619:Tll1 UTSW 8 64056273 missense probably benign 0.25
R1625:Tll1 UTSW 8 64041442 missense probably damaging 1.00
R1654:Tll1 UTSW 8 64117903 critical splice donor site probably null
R1663:Tll1 UTSW 8 64017686 missense probably benign 0.08
R1681:Tll1 UTSW 8 64085551 missense possibly damaging 0.93
R1713:Tll1 UTSW 8 64101873 missense probably damaging 0.99
R1908:Tll1 UTSW 8 64025107 missense probably damaging 0.98
R2118:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2121:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2124:Tll1 UTSW 8 64085557 missense probably benign 0.21
R2360:Tll1 UTSW 8 64051401 missense probably damaging 1.00
R2396:Tll1 UTSW 8 64070290 nonsense probably null
R3032:Tll1 UTSW 8 64098492 missense probably damaging 0.96
R3115:Tll1 UTSW 8 64053866 missense probably damaging 1.00
R3889:Tll1 UTSW 8 64205224 missense possibly damaging 0.77
R4126:Tll1 UTSW 8 64118014 missense possibly damaging 0.78
R4182:Tll1 UTSW 8 64041511 missense probably damaging 1.00
R4572:Tll1 UTSW 8 64056309 missense possibly damaging 0.81
R4677:Tll1 UTSW 8 64051377 missense probably benign 0.31
R4811:Tll1 UTSW 8 64085473 missense possibly damaging 0.72
R4904:Tll1 UTSW 8 64070199 missense probably benign 0.00
R4992:Tll1 UTSW 8 64093944 missense probably damaging 0.98
R5061:Tll1 UTSW 8 64053949 missense probably damaging 0.99
R5078:Tll1 UTSW 8 64093887 missense probably damaging 1.00
R5208:Tll1 UTSW 8 64051493 missense probably damaging 0.99
R5283:Tll1 UTSW 8 64101966 missense possibly damaging 0.68
R5399:Tll1 UTSW 8 64085488 missense probably damaging 1.00
R5699:Tll1 UTSW 8 64117940 missense probably damaging 0.98
R5986:Tll1 UTSW 8 64074263 missense probably damaging 0.99
R6019:Tll1 UTSW 8 64041491 missense possibly damaging 0.83
R6046:Tll1 UTSW 8 64053891 nonsense probably null
R6125:Tll1 UTSW 8 64051487 missense probably damaging 1.00
R6222:Tll1 UTSW 8 64098534 missense probably benign 0.18
R6275:Tll1 UTSW 8 64051367 nonsense probably null
R6508:Tll1 UTSW 8 64098460 missense probably damaging 0.99
R6758:Tll1 UTSW 8 64041405 critical splice donor site probably null
R6782:Tll1 UTSW 8 64071281 missense probably benign 0.00
R6848:Tll1 UTSW 8 64098510 missense probably damaging 0.99
R7057:Tll1 UTSW 8 64101881 missense probably damaging 1.00
R7144:Tll1 UTSW 8 64124945 missense possibly damaging 0.90
R7244:Tll1 UTSW 8 64025188 missense probably benign 0.00
R7336:Tll1 UTSW 8 64025142 missense probably damaging 0.98
R7373:Tll1 UTSW 8 64051357 missense probably damaging 0.98
R7626:Tll1 UTSW 8 64098234 splice site probably null
R7687:Tll1 UTSW 8 64121492 nonsense probably null
R7699:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7700:Tll1 UTSW 8 64093954 missense probably benign 0.00
R7765:Tll1 UTSW 8 64051449 missense probably damaging 1.00
R7790:Tll1 UTSW 8 64025237 nonsense probably null
R7954:Tll1 UTSW 8 64118534 missense probably damaging 1.00
R8710:Tll1 UTSW 8 64124906 missense possibly damaging 0.77
R8792:Tll1 UTSW 8 64085465 missense probably damaging 1.00
R9134:Tll1 UTSW 8 64016167 missense possibly damaging 0.91
R9444:Tll1 UTSW 8 64016089 missense probably damaging 1.00
X0020:Tll1 UTSW 8 64017628 missense probably damaging 0.97
Z1176:Tll1 UTSW 8 64047163 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTGTGGGTTAGCCAAGAAAG -3'
(R):5'- TTGCCAGCATTTCAGACTACAAAC -3'

Posted On 2018-03-16