Incidental Mutation 'R6142:Tanc1'
ID508658
Institutional Source Beutler Lab
Gene Symbol Tanc1
Ensembl Gene ENSMUSG00000035168
Gene Nametetratricopeptide repeat, ankyrin repeat and coiled-coil containing 1
Synonyms1200003E16Rik
MMRRC Submission 044289-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6142 (G1)
Quality Score74.0075
Status Validated
Chromosome2
Chromosomal Location59612042-59846149 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 59833222 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 1108 (R1108*)
Ref Sequence ENSEMBL: ENSMUSP00000123345 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037526] [ENSMUST00000112568] [ENSMUST00000139863]
Predicted Effect probably null
Transcript: ENSMUST00000037526
AA Change: R1108*
SMART Domains Protein: ENSMUSP00000036003
Gene: ENSMUSG00000035168
AA Change: R1108*

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000112568
AA Change: R1101*
SMART Domains Protein: ENSMUSP00000108187
Gene: ENSMUSG00000035168
AA Change: R1101*

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 432 444 N/A INTRINSIC
low complexity region 448 468 N/A INTRINSIC
ANK 886 918 1.06e3 SMART
ANK 922 953 2.43e3 SMART
ANK 957 986 1.12e-3 SMART
Blast:ANK 990 1021 7e-12 BLAST
ANK 1030 1059 1.78e3 SMART
ANK 1068 1097 2.34e-1 SMART
ANK 1101 1130 3.71e-4 SMART
ANK 1134 1163 1.51e-4 SMART
ANK 1167 1196 4.89e-4 SMART
ANK 1200 1229 3.01e-4 SMART
ANK 1233 1262 1.99e2 SMART
TPR 1279 1312 7.49e1 SMART
TPR 1326 1359 2.35e-1 SMART
TPR 1360 1393 6.29e-2 SMART
low complexity region 1409 1425 N/A INTRINSIC
low complexity region 1447 1476 N/A INTRINSIC
low complexity region 1649 1679 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000139863
AA Change: R1108*
SMART Domains Protein: ENSMUSP00000123345
Gene: ENSMUSG00000035168
AA Change: R1108*

DomainStartEndE-ValueType
low complexity region 7 22 N/A INTRINSIC
low complexity region 60 78 N/A INTRINSIC
low complexity region 171 191 N/A INTRINSIC
low complexity region 229 240 N/A INTRINSIC
low complexity region 439 451 N/A INTRINSIC
low complexity region 455 475 N/A INTRINSIC
ANK 893 925 1.06e3 SMART
ANK 929 960 2.43e3 SMART
ANK 964 993 1.12e-3 SMART
Blast:ANK 997 1028 7e-12 BLAST
ANK 1037 1066 1.78e3 SMART
ANK 1075 1104 2.34e-1 SMART
ANK 1108 1137 3.71e-4 SMART
ANK 1141 1170 1.51e-4 SMART
ANK 1174 1203 4.89e-4 SMART
ANK 1207 1236 3.01e-4 SMART
ANK 1240 1269 1.99e2 SMART
TPR 1286 1319 7.49e1 SMART
TPR 1333 1366 2.35e-1 SMART
TPR 1367 1400 6.29e-2 SMART
low complexity region 1416 1432 N/A INTRINSIC
low complexity region 1454 1483 N/A INTRINSIC
low complexity region 1656 1686 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 94.2%
Validation Efficiency 100% (48/48)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap vector exhibit decreased spine density in the CA3 region and impaired spatial memory. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy6 T C 15: 98,598,422 M579V probably benign Het
Agtr1b T C 3: 20,316,394 D16G probably benign Het
Akap12 C A 10: 4,313,740 probably null Het
Alpk2 T C 18: 65,305,385 E979G possibly damaging Het
Arfgap3 T C 15: 83,350,127 D8G probably damaging Het
AW551984 G T 9: 39,597,114 L369I probably benign Het
Bmp8b A T 4: 123,115,250 H207L probably benign Het
Cc2d2a G T 5: 43,703,198 V490F probably damaging Het
Cnot6l C T 5: 96,082,978 V377I probably benign Het
Col25a1 T A 3: 130,583,329 probably benign Het
Crocc2 C G 1: 93,190,479 Q375E possibly damaging Het
Ganc T C 2: 120,430,737 probably null Het
Gm28168 C A 1: 117,947,948 D102E probably benign Het
Gm8212 T C 14: 44,201,227 probably null Het
Gria2 T C 3: 80,801,717 T53A probably benign Het
Hipk4 G A 7: 27,529,165 V347M probably damaging Het
Hmgxb3 T C 18: 61,136,237 E991G probably benign Het
Hyal1 G A 9: 107,579,374 R420H probably benign Het
Il5 G A 11: 53,720,978 probably null Het
Kcnh7 T C 2: 62,739,360 I731V possibly damaging Het
Lamb2 A T 9: 108,485,618 K759* probably null Het
Lnpep A G 17: 17,566,681 probably null Het
Lrch1 T C 14: 74,947,500 E54G probably damaging Het
Msl3l2 A G 10: 56,115,365 D62G possibly damaging Het
Mslnl T C 17: 25,744,557 L339P probably damaging Het
Nfe2l2 T C 2: 75,679,417 I20V probably damaging Het
Pgm5 A C 19: 24,824,408 I152S probably damaging Het
Plcg2 C A 8: 117,585,271 T434K probably benign Het
Prrc2c T C 1: 162,710,387 E558G unknown Het
Ranbp3 T C 17: 56,686,018 V12A probably benign Het
Rgsl1 A G 1: 153,812,238 V635A probably benign Het
Rpap2 T C 5: 107,598,298 V14A probably benign Het
Rxrg G T 1: 167,632,622 A341S possibly damaging Het
Sbf2 A G 7: 110,348,975 S1177P probably damaging Het
Sema6a T C 18: 47,281,199 T498A probably benign Het
Slc13a4 G A 6: 35,301,783 A57V probably damaging Het
Slc6a3 A T 13: 73,544,783 D174V probably benign Het
Spg20 T G 3: 55,117,248 V88G probably damaging Het
Tas2r140 C T 6: 133,055,735 G20E probably damaging Het
Tdrd6 A G 17: 43,629,482 V225A probably benign Het
Tmem168 C A 6: 13,591,369 A99S probably benign Het
Tnk2 T A 16: 32,670,099 D252E probably damaging Het
Tpsg1 A T 17: 25,372,486 H20L probably benign Het
Tram1l1 T C 3: 124,321,443 F84S probably damaging Het
Vmn2r12 T A 5: 109,092,897 I117L probably benign Het
Zfp148 T C 16: 33,495,459 L219S possibly damaging Het
Zfp40 C A 17: 23,176,337 E425D probably benign Het
Zfp773 T C 7: 7,132,482 T372A probably benign Het
Other mutations in Tanc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Tanc1 APN 2 59790841 missense possibly damaging 0.84
IGL00484:Tanc1 APN 2 59793176 missense probably benign 0.00
IGL00688:Tanc1 APN 2 59815391 missense probably damaging 1.00
IGL00765:Tanc1 APN 2 59806301 missense probably benign 0.15
IGL01576:Tanc1 APN 2 59797735 missense probably damaging 1.00
IGL01590:Tanc1 APN 2 59785473 missense probably benign
IGL02016:Tanc1 APN 2 59843590 missense probably benign 0.00
IGL02373:Tanc1 APN 2 59796028 critical splice donor site probably null
IGL02539:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02540:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02541:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02543:Tanc1 APN 2 59833258 missense probably damaging 1.00
IGL02559:Tanc1 APN 2 59724654 splice site probably benign
IGL02626:Tanc1 APN 2 59799872 missense probably damaging 1.00
IGL02669:Tanc1 APN 2 59799986 missense probably damaging 1.00
IGL02902:Tanc1 APN 2 59793087 splice site probably benign
Oreja UTSW 2 59791804 synonymous silent
R0178:Tanc1 UTSW 2 59835447 nonsense probably null
R0347:Tanc1 UTSW 2 59842991 missense probably benign
R0570:Tanc1 UTSW 2 59796038 splice site probably benign
R0660:Tanc1 UTSW 2 59843884 nonsense probably null
R0664:Tanc1 UTSW 2 59843884 nonsense probably null
R0898:Tanc1 UTSW 2 59790788 missense probably damaging 1.00
R1333:Tanc1 UTSW 2 59843491 missense probably benign
R1575:Tanc1 UTSW 2 59791651 missense probably damaging 1.00
R1608:Tanc1 UTSW 2 59797694 missense possibly damaging 0.80
R1616:Tanc1 UTSW 2 59785387 missense probably damaging 1.00
R1703:Tanc1 UTSW 2 59843021 missense probably benign 0.02
R1727:Tanc1 UTSW 2 59790809 missense probably damaging 1.00
R1809:Tanc1 UTSW 2 59800097 missense probably damaging 1.00
R1812:Tanc1 UTSW 2 59791679 missense probably damaging 1.00
R1925:Tanc1 UTSW 2 59724751 missense possibly damaging 0.48
R1951:Tanc1 UTSW 2 59791812 missense possibly damaging 0.92
R2174:Tanc1 UTSW 2 59843833 missense possibly damaging 0.72
R2228:Tanc1 UTSW 2 59724724 missense probably benign 0.04
R2267:Tanc1 UTSW 2 59837219 critical splice donor site probably null
R4191:Tanc1 UTSW 2 59839013 missense probably damaging 1.00
R4476:Tanc1 UTSW 2 59841996 splice site probably null
R4632:Tanc1 UTSW 2 59795835 missense probably damaging 1.00
R4825:Tanc1 UTSW 2 59699422 missense probably damaging 1.00
R4982:Tanc1 UTSW 2 59799943 missense probably damaging 1.00
R5338:Tanc1 UTSW 2 59795834 missense probably damaging 1.00
R5657:Tanc1 UTSW 2 59834707 splice site probably null
R5672:Tanc1 UTSW 2 59772353 missense possibly damaging 0.81
R5703:Tanc1 UTSW 2 59795997 missense probably damaging 0.98
R5707:Tanc1 UTSW 2 59758530 missense probably benign
R5778:Tanc1 UTSW 2 59699347 critical splice acceptor site probably null
R5795:Tanc1 UTSW 2 59807582 missense possibly damaging 0.62
R5831:Tanc1 UTSW 2 59785341 missense possibly damaging 0.89
R5849:Tanc1 UTSW 2 59799904 missense probably benign 0.00
R5912:Tanc1 UTSW 2 59791686 missense possibly damaging 0.92
R5944:Tanc1 UTSW 2 59837220 critical splice donor site probably null
R6057:Tanc1 UTSW 2 59817493 missense possibly damaging 0.46
R6179:Tanc1 UTSW 2 59842976 missense probably benign 0.42
R6185:Tanc1 UTSW 2 59791585 splice site probably null
R6192:Tanc1 UTSW 2 59838961 splice site probably null
R6196:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6197:Tanc1 UTSW 2 59844022 missense possibly damaging 0.94
R6230:Tanc1 UTSW 2 59842031 missense probably damaging 1.00
R6275:Tanc1 UTSW 2 59843510 missense probably benign 0.22
R6415:Tanc1 UTSW 2 59837114 missense probably benign 0.02
R6480:Tanc1 UTSW 2 59807642 missense probably damaging 1.00
R6578:Tanc1 UTSW 2 59795954 missense probably damaging 1.00
R6786:Tanc1 UTSW 2 59791806 missense probably benign 0.00
R7006:Tanc1 UTSW 2 59795844 missense probably damaging 1.00
R7133:Tanc1 UTSW 2 59797609 missense probably benign 0.16
R7381:Tanc1 UTSW 2 59785326 missense probably damaging 1.00
R7422:Tanc1 UTSW 2 59806344 missense probably benign 0.02
X0063:Tanc1 UTSW 2 59843980 nonsense probably null
X0064:Tanc1 UTSW 2 59844112 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACATTAGTGTACTGCCGCTG -3'
(R):5'- TCTGAGAAGCAGTCACAAGG -3'

Sequencing Primer
(F):5'- TGTGCTCAATGGATCCCG -3'
(R):5'- GTCACAAGGACATGGGAGG -3'
Posted On2018-03-16