Incidental Mutation 'R5903:Pdzd8'
ID 508670
Institutional Source Beutler Lab
Gene Symbol Pdzd8
Ensembl Gene ENSMUSG00000074746
Gene Name PDZ domain containing 8
Synonyms A630041P07Rik, Pdzk8
MMRRC Submission 044101-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R5903 (G1)
Quality Score 24
Status Validated
Chromosome 19
Chromosomal Location 59296084-59345780 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59345286 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 101 (I101T)
Ref Sequence ENSEMBL: ENSMUSP00000096880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099274]
AlphaFold B9EJ80
Predicted Effect possibly damaging
Transcript: ENSMUST00000099274
AA Change: I101T

PolyPhen 2 Score 0.580 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000096880
Gene: ENSMUSG00000074746
AA Change: I101T

DomainStartEndE-ValueType
transmembrane domain 2 24 N/A INTRINSIC
low complexity region 75 90 N/A INTRINSIC
PDZ 374 448 2.02e-10 SMART
low complexity region 582 596 N/A INTRINSIC
low complexity region 802 814 N/A INTRINSIC
C1 834 884 8.31e-8 SMART
coiled coil region 1021 1057 N/A INTRINSIC
Meta Mutation Damage Score 0.3303 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.8%
Validation Efficiency 98% (58/59)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130230L23Rik A G 5: 65,988,318 V150A unknown Het
Abraxas1 T C 5: 100,817,958 probably null Het
Actl7a G T 4: 56,743,827 R118L probably damaging Het
Atg2b T C 12: 105,639,359 D1449G possibly damaging Het
Atg7 G A 6: 114,706,293 W439* probably null Het
Atp6v0a2 T A 5: 124,712,279 I370N probably damaging Het
B4galt1 T C 4: 40,807,760 D347G probably damaging Het
Baz2b C T 2: 59,959,889 C660Y probably damaging Het
Ccdc88c T C 12: 100,930,542 Y1390C probably damaging Het
Cdcp1 G A 9: 123,173,772 Q745* probably null Het
Cep97 G A 16: 55,919,526 S185L probably damaging Het
Clec4d A G 6: 123,267,061 H43R probably damaging Het
Cntn3 T A 6: 102,242,133 M509L probably benign Het
Cntrob A C 11: 69,309,375 S564R possibly damaging Het
Cyp2j8 T A 4: 96,507,277 N37I possibly damaging Het
Edc4 A G 8: 105,890,587 T1029A probably benign Het
Fam160b2 A T 14: 70,591,681 V64E probably damaging Het
Fmnl1 G T 11: 103,171,444 probably null Het
Fzd6 T A 15: 39,007,388 M1K probably null Het
Gle1 C A 2: 29,940,281 T283N probably benign Het
Hsd17b14 T C 7: 45,565,962 V161A probably damaging Het
Hsf2 T C 10: 57,504,723 S218P probably benign Het
Ipo7 T A 7: 110,050,813 C736S probably damaging Het
Itpkb G T 1: 180,413,975 V737L probably damaging Het
Itpr1 T C 6: 108,489,797 probably benign Het
Kcnh8 G T 17: 52,803,336 V192L possibly damaging Het
Kctd10 G A 5: 114,380,462 probably benign Het
Kdm3a C A 6: 71,632,250 probably benign Het
Kif5a T A 10: 127,230,578 M990L probably benign Het
Klf12 A G 14: 100,022,688 S202P probably damaging Het
Krt81 T G 15: 101,460,202 Q390P probably damaging Het
Lrig3 T C 10: 126,008,478 S604P probably damaging Het
Ms4a1 A T 19: 11,258,248 V48D probably damaging Het
Mta1 C T 12: 113,136,619 P688L probably damaging Het
Oas1h T C 5: 120,870,977 V250A probably damaging Het
Olfr618 G T 7: 103,597,921 G202* probably null Het
Olfr95 A T 17: 37,211,021 Y277* probably null Het
P2rx3 T C 2: 85,000,727 E265G possibly damaging Het
Psme4 A T 11: 30,841,589 N1148I probably benign Het
Rnf213 T C 11: 119,421,369 L874P probably damaging Het
Sart3 T C 5: 113,751,239 Y508C probably damaging Het
Sez6l2 T C 7: 126,970,133 probably benign Het
Slc9b1 C T 3: 135,392,894 probably benign Het
Stmn3 T C 2: 181,308,780 K78E possibly damaging Het
Thsd4 T A 9: 60,394,106 N302I possibly damaging Het
Trdv5 A T 14: 54,148,785 H74Q probably benign Het
Tubb4b C T 2: 25,223,981 R77H probably benign Het
Ugt1a6a C T 1: 88,215,123 P113L probably damaging Het
Unc5a T A 13: 54,999,690 C438S possibly damaging Het
Zan C A 5: 137,442,134 C1946F unknown Het
Other mutations in Pdzd8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Pdzd8 APN 19 59299786 missense probably damaging 1.00
IGL01321:Pdzd8 APN 19 59301529 missense probably benign
IGL01865:Pdzd8 APN 19 59299645 missense possibly damaging 0.92
IGL02044:Pdzd8 APN 19 59315292 missense possibly damaging 0.85
IGL02119:Pdzd8 APN 19 59300490 missense possibly damaging 0.95
IGL02186:Pdzd8 APN 19 59300628 missense probably damaging 1.00
IGL02389:Pdzd8 APN 19 59301393 missense probably benign 0.00
IGL02479:Pdzd8 APN 19 59299783 nonsense probably null
IGL02713:Pdzd8 APN 19 59345458 missense probably damaging 0.98
IGL02958:Pdzd8 APN 19 59300372 nonsense probably null
IGL02966:Pdzd8 APN 19 59300859 missense probably damaging 1.00
IGL03166:Pdzd8 APN 19 59300508 missense probably damaging 1.00
citadel UTSW 19 59299525 makesense probably null
Eleventh_hour UTSW 19 59305230 missense probably damaging 1.00
keep UTSW 19 59301351 nonsense probably null
Stronghold UTSW 19 59345352 nonsense probably null
R0018:Pdzd8 UTSW 19 59300673 missense probably damaging 1.00
R0038:Pdzd8 UTSW 19 59299596 missense possibly damaging 0.54
R0196:Pdzd8 UTSW 19 59301131 missense probably benign 0.00
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0233:Pdzd8 UTSW 19 59300379 missense probably damaging 0.99
R0418:Pdzd8 UTSW 19 59300929 missense probably damaging 1.00
R0736:Pdzd8 UTSW 19 59344933 missense probably damaging 0.99
R1456:Pdzd8 UTSW 19 59300472 missense probably benign 0.01
R1709:Pdzd8 UTSW 19 59301339 missense probably benign
R1965:Pdzd8 UTSW 19 59300122 missense probably benign 0.37
R2155:Pdzd8 UTSW 19 59300421 missense probably damaging 1.00
R3077:Pdzd8 UTSW 19 59305156 critical splice donor site probably null
R3411:Pdzd8 UTSW 19 59345413 missense probably damaging 1.00
R4345:Pdzd8 UTSW 19 59300128 missense probably benign 0.00
R4354:Pdzd8 UTSW 19 59345481 missense probably benign
R4504:Pdzd8 UTSW 19 59345448 missense probably damaging 1.00
R4642:Pdzd8 UTSW 19 59305230 missense probably damaging 1.00
R4705:Pdzd8 UTSW 19 59345311 missense possibly damaging 0.80
R4773:Pdzd8 UTSW 19 59300860 missense probably damaging 1.00
R4876:Pdzd8 UTSW 19 59300804 nonsense probably null
R5176:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R5267:Pdzd8 UTSW 19 59301026 missense probably damaging 1.00
R5707:Pdzd8 UTSW 19 59299625 missense probably benign 0.00
R5766:Pdzd8 UTSW 19 59300540 missense possibly damaging 0.65
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6036:Pdzd8 UTSW 19 59305209 missense probably damaging 1.00
R6238:Pdzd8 UTSW 19 59300562 missense probably benign 0.05
R6360:Pdzd8 UTSW 19 59300983 missense probably benign 0.10
R6509:Pdzd8 UTSW 19 59344866 missense probably benign 0.01
R6674:Pdzd8 UTSW 19 59301369 missense probably damaging 1.00
R6808:Pdzd8 UTSW 19 59299525 makesense probably null
R6902:Pdzd8 UTSW 19 59301397 missense possibly damaging 0.91
R7017:Pdzd8 UTSW 19 59345352 nonsense probably null
R7088:Pdzd8 UTSW 19 59344957 missense probably damaging 1.00
R7116:Pdzd8 UTSW 19 59299693 missense probably damaging 1.00
R7158:Pdzd8 UTSW 19 59300157 missense probably damaging 1.00
R7237:Pdzd8 UTSW 19 59345139 missense probably damaging 1.00
R7251:Pdzd8 UTSW 19 59300645 missense possibly damaging 0.96
R7314:Pdzd8 UTSW 19 59301351 nonsense probably null
R7699:Pdzd8 UTSW 19 59344941 missense probably damaging 1.00
R7751:Pdzd8 UTSW 19 59344776 missense probably damaging 0.98
R7759:Pdzd8 UTSW 19 59299926 missense probably damaging 1.00
R7784:Pdzd8 UTSW 19 59327863 missense probably damaging 1.00
R7917:Pdzd8 UTSW 19 59345086 missense probably damaging 0.96
R9364:Pdzd8 UTSW 19 59345142 missense probably damaging 1.00
R9368:Pdzd8 UTSW 19 59300787 nonsense probably null
R9406:Pdzd8 UTSW 19 59344813 missense
R9548:Pdzd8 UTSW 19 59301394 missense probably benign 0.13
R9554:Pdzd8 UTSW 19 59345142 missense probably damaging 1.00
R9688:Pdzd8 UTSW 19 59345251 missense probably benign 0.05
R9750:Pdzd8 UTSW 19 59301252 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGTCTTGATGAAGGGCAC -3'
(R):5'- TGCTACTCTACCGCAGACAG -3'

Sequencing Primer
(F):5'- ACCGTGTCGCCCAGGAAC -3'
(R):5'- TACCGCAGACAGCCCGAG -3'
Posted On 2018-03-23