Mutagenetix > Incidental Mutation

Incidental Mutation 'R6048:Ntn4'

508674

Institutional Source

Beutler Lab

Gene Symbol

Ntn4

Ensembl Gene

ENSMUSG00000020019

Gene Name

netrin 4

Synonyms

beta-netrin

MMRRC Submission

044216-MU

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6048 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93640681-93747207 bp(+) (GRCm38)

Type of Mutation

splice site

DNA Base Change (assembly)

T to A at 93707266 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Ref Sequence

ENSEMBL: ENSMUSP00000020204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020204] [ENSMUST00000020204]

AlphaFold

Q9JI33

Predicted Effect

probably null
Transcript: ENSMUST00000020204

SMART Domains

Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	28	260	6.48e-55	SMART
EGF_Lam	262	329	5.83e-7	SMART
EGF_Lam	332	392	3.32e-11	SMART
EGF_Lam	395	446	3.73e-14	SMART
C345C	516	625	5.58e-25	SMART

Predicted Effect

probably null
Transcript: ENSMUST00000020204

SMART Domains

Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	28	260	6.48e-55	SMART
EGF_Lam	262	329	5.83e-7	SMART
EGF_Lam	332	392	3.32e-11	SMART
EGF_Lam	395	446	3.73e-14	SMART
C345C	516	625	5.58e-25	SMART

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 97.9%
20x: 93.5%

Validation Efficiency

98% (60/61)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 62 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
2010111I01Rik	T	A	13: 63,240,325	F39L	probably damaging	Het
Aldh1a2	T	C	9: 71,261,767	I177T	probably damaging	Het
Arl4c	A	G	1: 88,701,628	S13P	possibly damaging	Het
Bst1	G	T	5: 43,818,964		probably benign	Het
Carmil3	G	A	14: 55,503,845	R1029Q	probably benign	Het
Cflar	A	G	1: 58,741,043	T269A	probably benign	Het
Clcnka	T	A	4: 141,394,487	Y236F	probably damaging	Het
Clmp	T	A	9: 40,771,109	I63N	probably damaging	Het
Cln6	T	C	9: 62,844,626	L44P	probably damaging	Het
Col5a3	C	T	9: 20,807,619	A280T	unknown	Het
Dact2	A	G	17: 14,197,305	L211P	probably damaging	Het
Dclk2	G	T	3: 86,905,965	Q225K	probably damaging	Het
Ddx60	T	C	8: 62,000,582	F1245S	probably benign	Het
Eif3i	T	C	4: 129,593,352	N240S	probably benign	Het
Enpp1	T	C	10: 24,660,254	Y416C	probably damaging	Het
Epb42	T	A	2: 121,024,408	R565S	probably benign	Het
Eral1	G	A	11: 78,075,783	P217L	probably benign	Het
Fbxl16	A	G	17: 25,816,993	Y188C	probably benign	Het
Fgd3	G	A	13: 49,273,748	P503S	probably benign	Het
Frem3	T	C	8: 80,613,433	L785P	probably benign	Het
Gadl1	A	G	9: 116,006,701		probably null	Het
Gm10787	C	T	10: 77,021,842		noncoding transcript	Het
Gm11639	A	G	11: 104,944,433	K3540E	unknown	Het
Gm17359	T	C	3: 79,405,885	S89P	probably damaging	Het
Gm6563	A	G	19: 23,675,882	K12R	probably benign	Het
Grm5	T	C	7: 88,026,550	L424P	probably damaging	Het
Hist1h2ag	A	G	13: 22,042,836	V31A	probably benign	Het
Il17re	T	C	6: 113,470,108	S607P	possibly damaging	Het
Ints7	A	G	1: 191,621,412		probably benign	Het
Itih1	A	G	14: 30,929,823	M854T	possibly damaging	Het
Kif1b	A	G	4: 149,263,629	L315P	probably damaging	Het
Ms4a6b	T	C	19: 11,520,370	V11A	possibly damaging	Het
Mxd1	C	A	6: 86,650,984	D191Y	probably damaging	Het
Nol8	T	A	13: 49,653,684		probably null	Het
Nxph1	A	T	6: 9,247,103	T25S	probably benign	Het
Olfr1344	A	C	7: 6,440,355	T152P	possibly damaging	Het
Olfr202	C	T	16: 59,283,979	V173I	probably benign	Het
Olfr351	A	G	2: 36,859,841	V169A	probably benign	Het
Olfr410	A	T	11: 74,335,135	I32K	probably benign	Het
Olfr583	A	G	7: 103,051,319	N7S	probably benign	Het
Olfr818	A	G	10: 129,945,826	F79L	possibly damaging	Het
Oxsm	T	A	14: 16,242,308	M154L	possibly damaging	Het
Papolg	A	C	11: 23,891,815	I36S	probably benign	Het
Pde3b	T	A	7: 114,508,267	H544Q	probably benign	Het
Pdzd2	A	T	15: 12,592,570		probably null	Het
Prkce	C	A	17: 86,493,347	P397Q	probably benign	Het
Ralgapa2	T	C	2: 146,434,845	S492G	possibly damaging	Het
Rnf216	A	G	5: 143,068,904	Y630H	probably damaging	Het
Ruvbl1	C	T	6: 88,482,991	T211I	possibly damaging	Het
Scyl2	A	T	10: 89,645,486	D666E	probably benign	Het
Sertad2	A	G	11: 20,648,436	T211A	probably benign	Het
Sipa1l1	A	T	12: 82,440,869	Q1639L	probably benign	Het
Snx5	T	C	2: 144,259,153	D98G	probably damaging	Het
Sorcs2	G	T	5: 36,027,988		probably null	Het
Tanc2	G	A	11: 105,867,717	R768Q	probably damaging	Het
Tmem132d	A	G	5: 128,269,117	S114P	probably benign	Het
Tns2	G	A	15: 102,111,411	G579R	probably damaging	Het
Usp37	A	T	1: 74,478,136		probably null	Het
Vmn1r79	T	C	7: 12,176,521	I110T	probably damaging	Het
Vps37a	C	T	8: 40,528,322	L69F	probably damaging	Het
Xirp2	T	A	2: 67,508,243	I276N	possibly damaging	Het
Zfp946	G	A	17: 22,454,840	E192K	probably benign	Het

Other mutations in Ntn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02052:Ntn4	APN	10	93707349	missense	probably damaging	1.00
IGL02212:Ntn4	APN	10	93644849	missense	possibly damaging	0.50
IGL02698:Ntn4	APN	10	93644659	missense	probably benign	0.19
IGL02752:Ntn4	APN	10	93710559	missense	possibly damaging	0.84
PIT4468001:Ntn4	UTSW	10	93644725	missense	probably damaging	0.99
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0132:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0419:Ntn4	UTSW	10	93682429	missense	probably benign	0.04
R1304:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1306:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1307:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1308:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1619:Ntn4	UTSW	10	93644734	missense	probably damaging	1.00
R1645:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1664:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1695:Ntn4	UTSW	10	93733602	splice site	probably null
R1796:Ntn4	UTSW	10	93745771	missense	probably damaging	1.00
R1806:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1845:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1856:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1872:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1879:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1901:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1902:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1925:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1926:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1927:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2060:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2113:Ntn4	UTSW	10	93644839	missense	probably damaging	1.00
R2202:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2203:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2975:Ntn4	UTSW	10	93644891	missense	probably damaging	1.00
R4277:Ntn4	UTSW	10	93741210	missense	possibly damaging	0.95
R4805:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4806:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4807:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R5818:Ntn4	UTSW	10	93644764	missense	probably benign	0.40
R6051:Ntn4	UTSW	10	93745795	missense	probably benign
R6346:Ntn4	UTSW	10	93644861	missense	probably damaging	1.00
R6752:Ntn4	UTSW	10	93734175	missense	probably benign
R7196:Ntn4	UTSW	10	93733714	missense	probably benign	0.01
R7240:Ntn4	UTSW	10	93745741	missense	probably damaging	0.99
R7365:Ntn4	UTSW	10	93644804	missense	probably damaging	1.00
R7374:Ntn4	UTSW	10	93682572	missense	probably benign
R7505:Ntn4	UTSW	10	93707284	missense	probably damaging	1.00
R7509:Ntn4	UTSW	10	93710568	missense	probably benign	0.01
R7726:Ntn4	UTSW	10	93733682	missense	possibly damaging	0.82
R7957:Ntn4	UTSW	10	93644473	splice site	probably benign
R8092:Ntn4	UTSW	10	93741056	missense	probably damaging	0.97
R8202:Ntn4	UTSW	10	93644903	missense	possibly damaging	0.88
R8508:Ntn4	UTSW	10	93741104	missense	possibly damaging	0.48
R9010:Ntn4	UTSW	10	93644644	missense
R9115:Ntn4	UTSW	10	93733813	missense	probably benign
R9415:Ntn4	UTSW	10	93644626	missense	probably benign	0.00
RF045:Ntn4	UTSW	10	93710625	missense	possibly damaging	0.95
X0024:Ntn4	UTSW	10	93644971	missense	probably damaging	1.00
Z1176:Ntn4	UTSW	10	93741153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGCAGAATTTCTCACTGGAGC -3'
(R):5'- CAGGCTGTTTCCAACGGTTG -3'

Sequencing Primer
(F):5'- GAATTTCTCACTGGAGCCATATATTC -3'
(R):5'- AACGGTTGGAGTCACGCTG -3'

Posted On

2018-03-23