Incidental Mutation 'R5860:Exosc8'
ID508676
Institutional Source Beutler Lab
Gene Symbol Exosc8
Ensembl Gene ENSMUSG00000027752
Gene Nameexosome component 8
Synonyms
MMRRC Submission 044072-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5860 (G1)
Quality Score25
Status Validated
Chromosome3
Chromosomal Location54728678-54735393 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) C to T at 54735042 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000119260 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029316] [ENSMUST00000044567] [ENSMUST00000141191] [ENSMUST00000153224] [ENSMUST00000154787] [ENSMUST00000155273]
Predicted Effect probably benign
Transcript: ENSMUST00000029316
SMART Domains Protein: ENSMUSP00000029316
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 31 166 2.3e-29 PFAM
Pfam:RNase_PH_C 191 258 8.9e-15 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000044567
SMART Domains Protein: ENSMUSP00000035879
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 7 29 N/A INTRINSIC
Pfam:Glyco_tranf_2_3 63 174 2.1e-10 PFAM
Pfam:Glycos_transf_2 68 250 2.9e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127112
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134892
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135935
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140935
Predicted Effect probably benign
Transcript: ENSMUST00000141191
SMART Domains Protein: ENSMUSP00000118818
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143387
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150923
Predicted Effect probably benign
Transcript: ENSMUST00000153224
SMART Domains Protein: ENSMUSP00000118780
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 31 130 2e-16 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154787
SMART Domains Protein: ENSMUSP00000115876
Gene: ENSMUSG00000027752

DomainStartEndE-ValueType
Pfam:RNase_PH 19 106 5.7e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155273
SMART Domains Protein: ENSMUSP00000119260
Gene: ENSMUSG00000036632

DomainStartEndE-ValueType
transmembrane domain 4 26 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198780
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.1%
  • 20x: 90.8%
Validation Efficiency 97% (75/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 3'-5' exoribonuclease that specifically interacts with mRNAs containing AU-rich elements. The encoded protein is part of the exosome complex that is important for the degradation of numerous RNA species. A pseudogene of this gene is found on chromosome 6. [provided by RefSeq, Mar 2009]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930568A12Rik A G 1: 34,485,580 noncoding transcript Het
A2ml1 T C 6: 128,541,061 T1421A probably benign Het
Actr8 T A 14: 29,986,285 Y150* probably null Het
Adamts1 A G 16: 85,798,544 C249R probably damaging Het
Adgre1 T A 17: 57,445,034 I594N probably damaging Het
Atf6 A T 1: 170,841,775 L119H probably damaging Het
Atf6 G A 1: 170,841,776 L119F possibly damaging Het
B3gat2 G A 1: 23,815,319 W33* probably null Het
Bach2 A G 4: 32,580,268 D831G probably damaging Het
Ccnk A T 12: 108,187,207 I76F probably damaging Het
Cdyl A C 13: 35,858,083 K368T possibly damaging Het
Chil1 A G 1: 134,185,171 T114A probably benign Het
Cnppd1 A G 1: 75,136,487 V379A probably benign Het
Col11a2 C A 17: 34,064,185 probably benign Het
Creb3l1 T C 2: 92,024,054 S18G probably benign Het
Crybg3 A C 16: 59,565,269 D197E probably damaging Het
Cryga T C 1: 65,103,368 probably benign Het
Cthrc1 T C 15: 39,086,685 C146R probably damaging Het
Cyhr1 A T 15: 76,648,191 I239N probably damaging Het
Cyhr1 T C 15: 76,656,415 Y101C probably damaging Het
Cyp2c39 A T 19: 39,536,826 D191V probably damaging Het
Dchs1 C T 7: 105,772,035 A393T probably damaging Het
Dhx30 G A 9: 110,084,577 T1126I probably damaging Het
Dock2 C T 11: 34,256,562 G1345R probably damaging Het
Dsc1 T C 18: 20,095,024 E425G probably damaging Het
Fat1 C T 8: 45,051,129 A4553V probably benign Het
Flnb T A 14: 7,931,135 L2119Q probably damaging Het
Fnbp4 T A 2: 90,757,482 D401E probably benign Het
Glyctk T C 9: 106,155,707 E369G possibly damaging Het
Gm14149 C A 2: 151,224,305 noncoding transcript Het
Golga4 T C 9: 118,558,106 L1432P probably damaging Het
Gtpbp4 A T 13: 8,973,160 S623T probably benign Het
Insc A C 7: 114,791,148 S85R probably damaging Het
Lgr4 G A 2: 109,991,151 R126H probably damaging Het
M1ap T A 6: 83,003,814 L227Q probably damaging Het
March7 T C 2: 60,236,843 I569T probably damaging Het
Mbd1 C A 18: 74,276,697 C339* probably null Het
Moxd2 T A 6: 40,880,407 Y473F probably damaging Het
Mrgpra6 T C 7: 47,189,351 H2R probably benign Het
Mtus1 T G 8: 41,076,266 L742F probably damaging Het
Nek11 A G 9: 105,392,961 Y21H probably benign Het
Notch4 G T 17: 34,582,418 C1080F probably damaging Het
Nsd3 C A 8: 25,666,091 P558Q probably damaging Het
Oas1e A T 5: 120,791,950 S168T probably benign Het
Ogfr T C 2: 180,592,492 S119P probably damaging Het
Olfr1387 A G 11: 49,459,736 D19G probably damaging Het
Olfr44 T A 9: 39,484,471 M261L probably benign Het
Pde4dip A G 3: 97,724,188 I1135T possibly damaging Het
Prex1 G A 2: 166,644,684 probably benign Het
Ptprf T C 4: 118,211,289 probably benign Het
Rapsn T C 2: 91,045,514 V359A probably damaging Het
Ric1 A G 19: 29,599,845 S1050G possibly damaging Het
Rnft2 A G 5: 118,228,803 I290T possibly damaging Het
Senp7 C A 16: 56,155,359 A476E possibly damaging Het
Serpinh1 G A 7: 99,346,364 S337L probably damaging Het
Slc5a12 C A 2: 110,597,624 A8D probably benign Het
Smg5 T A 3: 88,342,907 C109S probably damaging Het
Speer4b T C 5: 27,500,228 H49R possibly damaging Het
Tas2r109 T C 6: 132,980,701 I89V probably benign Het
Tctex1d2 A G 16: 32,428,796 Y143C probably damaging Het
Tet1 A G 10: 62,812,620 probably null Het
Tmed6 G T 8: 107,064,154 T87K probably damaging Het
Tpgs1 G A 10: 79,669,711 G101D probably damaging Het
Trim13 T G 14: 61,604,739 S68R probably damaging Het
Vwf A G 6: 125,643,090 N1577S Het
Vwf G T 6: 125,679,265 probably benign Het
Xpr1 T C 1: 155,332,122 probably benign Het
Ylpm1 C T 12: 85,040,886 P1148L probably damaging Het
Zscan29 G T 2: 121,164,037 T489N probably damaging Het
Other mutations in Exosc8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01448:Exosc8 APN 3 54729265 missense probably damaging 0.97
IGL03348:Exosc8 APN 3 54732722 missense possibly damaging 0.91
R1037:Exosc8 UTSW 3 54732738 missense probably damaging 0.98
R1233:Exosc8 UTSW 3 54731998 missense probably benign 0.30
R1623:Exosc8 UTSW 3 54734331 missense probably damaging 0.99
R1647:Exosc8 UTSW 3 54734101 critical splice donor site probably null
R1928:Exosc8 UTSW 3 54728845 missense probably damaging 1.00
R3005:Exosc8 UTSW 3 54732147 synonymous probably null
R4851:Exosc8 UTSW 3 54732102 unclassified probably benign
R4932:Exosc8 UTSW 3 54729290 missense possibly damaging 0.81
R5010:Exosc8 UTSW 3 54729223 missense probably benign 0.00
R5506:Exosc8 UTSW 3 54731179 unclassified probably benign
R6887:Exosc8 UTSW 3 54733699 missense probably damaging 1.00
R7543:Exosc8 UTSW 3 54729248 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- AGTGACTGCAGGTAGGTACG -3'
(R):5'- GTGCAGAGCAGCCATCTAAG -3'

Sequencing Primer
(F):5'- TCCGGGTTTAACCAGAGCG -3'
(R):5'- AGCCATCTAAGGATGCCCG -3'
Posted On2018-03-29