Incidental Mutation 'R6295:Atg9a'
ID 508688
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Name autophagy related 9A
Synonyms Apg9l1
MMRRC Submission 044463-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R6295 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 75157509-75168654 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 75161702 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Proline at position 615 (S615P)
Ref Sequence ENSEMBL: ENSMUSP00000139641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027396] [ENSMUST00000040689] [ENSMUST00000188347] [ENSMUST00000189702] [ENSMUST00000189665]
AlphaFold Q68FE2
Predicted Effect probably benign
Transcript: ENSMUST00000027396
SMART Domains Protein: ENSMUSP00000027396
Gene: ENSMUSG00000026198

DomainStartEndE-ValueType
Pfam:MTABC_N 6 255 7.8e-80 PFAM
Pfam:ABC_membrane 265 544 3.7e-34 PFAM
AAA 615 816 1.29e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040689
AA Change: S615P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: S615P

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect probably benign
Transcript: ENSMUST00000188347
AA Change: S615P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: S615P

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189702
AA Change: S615P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: S615P

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000187785
AA Change: S174P
Predicted Effect unknown
Transcript: ENSMUST00000189820
AA Change: S607P
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187601
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188430
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,838,379 (GRCm39) V1061G probably damaging Het
Acap1 A G 11: 69,781,413 (GRCm39) probably null Het
Apbb1 A G 7: 105,215,902 (GRCm39) F112L probably benign Het
Atp8a2 G A 14: 60,249,848 (GRCm39) R548* probably null Het
Bbof1 A T 12: 84,457,942 (GRCm39) N69I possibly damaging Het
Bcl2l14 T A 6: 134,404,370 (GRCm39) V186D probably benign Het
Bmp1 T G 14: 70,728,823 (GRCm39) Y583S possibly damaging Het
Boc A C 16: 44,312,711 (GRCm39) S586R probably benign Het
Btbd9 A T 17: 30,518,710 (GRCm39) probably null Het
Cacna1e T C 1: 154,317,919 (GRCm39) M1180V probably damaging Het
Ciao1 T C 2: 127,088,376 (GRCm39) H149R probably damaging Het
Cops5 T C 1: 10,100,920 (GRCm39) probably benign Het
Doc2b C T 11: 75,671,093 (GRCm39) R209Q probably damaging Het
Doc2b T C 11: 75,686,451 (GRCm39) Y90C probably benign Het
Ep400 A G 5: 110,901,675 (GRCm39) F481L probably benign Het
Fat4 T A 3: 39,061,229 (GRCm39) probably null Het
Fbxw16 T A 9: 109,277,837 (GRCm39) probably benign Het
Fbxw27 T C 9: 109,601,154 (GRCm39) E17G possibly damaging Het
Gm29735 G A 7: 141,710,367 (GRCm39) P162S unknown Het
Gypa T G 8: 81,222,969 (GRCm39) S24R unknown Het
Hdhd5 T C 6: 120,495,485 (GRCm39) N153D probably benign Het
Ibsp C A 5: 104,449,987 (GRCm39) probably null Het
Klhdc3 C T 17: 46,988,972 (GRCm39) V73I probably benign Het
Lrrc37a T C 11: 103,388,459 (GRCm39) E2322G unknown Het
Lrrtm3 T C 10: 63,765,913 (GRCm39) H558R probably benign Het
Mbtd1 C T 11: 93,823,058 (GRCm39) H493Y possibly damaging Het
Mphosph9 A G 5: 124,458,978 (GRCm39) V64A possibly damaging Het
Nthl1 C T 17: 24,857,475 (GRCm39) R251C probably damaging Het
Numa1 G A 7: 101,649,974 (GRCm39) R1235H probably benign Het
Opn1sw T A 6: 29,379,413 (GRCm39) Y197F possibly damaging Het
Or10a3m T C 7: 108,312,845 (GRCm39) V95A probably damaging Het
Pcca A T 14: 122,896,187 (GRCm39) I268F probably benign Het
Per2 A T 1: 91,377,594 (GRCm39) D76E unknown Het
Pfas T C 11: 68,888,825 (GRCm39) N374S probably benign Het
Pomk C A 8: 26,472,955 (GRCm39) V333F probably damaging Het
Ptgfr T C 3: 151,540,926 (GRCm39) E194G probably benign Het
Ptpn14 C T 1: 189,582,997 (GRCm39) P615S probably damaging Het
Pyroxd1 T C 6: 142,300,479 (GRCm39) I203T probably benign Het
Rgs22 T C 15: 36,087,520 (GRCm39) N466S probably benign Het
Rpl3l G A 17: 24,952,966 (GRCm39) V309I probably benign Het
Rtkn2 C T 10: 67,815,529 (GRCm39) probably benign Het
Sec16a C T 2: 26,318,253 (GRCm39) A1613T probably damaging Het
Sis T A 3: 72,874,103 (GRCm39) T33S probably damaging Het
Slc22a4 C A 11: 53,898,634 (GRCm39) V153F possibly damaging Het
Stxbp1 C G 2: 32,684,621 (GRCm39) E603Q probably damaging Het
Tiam2 A G 17: 3,559,831 (GRCm39) S1291G probably damaging Het
Tmem94 T A 11: 115,687,572 (GRCm39) L1144M probably damaging Het
Ttn G A 2: 76,579,673 (GRCm39) T23740M probably damaging Het
Vmn1r201 T C 13: 22,659,533 (GRCm39) V249A probably benign Het
Wdr7 T A 18: 63,888,182 (GRCm39) C552S probably damaging Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75,167,010 (GRCm39) missense probably damaging 1.00
IGL02041:Atg9a APN 1 75,159,748 (GRCm39) missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75,164,601 (GRCm39) missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75,164,597 (GRCm39) nonsense probably null
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0054:Atg9a UTSW 1 75,161,143 (GRCm39) missense probably damaging 1.00
R0408:Atg9a UTSW 1 75,161,939 (GRCm39) missense probably damaging 1.00
R0520:Atg9a UTSW 1 75,163,178 (GRCm39) nonsense probably null
R0653:Atg9a UTSW 1 75,166,972 (GRCm39) missense probably damaging 0.96
R0666:Atg9a UTSW 1 75,161,734 (GRCm39) missense probably damaging 0.99
R0961:Atg9a UTSW 1 75,163,390 (GRCm39) missense probably damaging 0.99
R1489:Atg9a UTSW 1 75,162,734 (GRCm39) missense probably damaging 1.00
R1490:Atg9a UTSW 1 75,162,389 (GRCm39) missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75,166,999 (GRCm39) missense probably benign 0.04
R1997:Atg9a UTSW 1 75,166,270 (GRCm39) missense probably benign 0.33
R2005:Atg9a UTSW 1 75,162,635 (GRCm39) missense probably benign 0.18
R2172:Atg9a UTSW 1 75,162,329 (GRCm39) missense probably damaging 0.99
R4004:Atg9a UTSW 1 75,163,095 (GRCm39) missense probably damaging 1.00
R4105:Atg9a UTSW 1 75,162,603 (GRCm39) missense probably damaging 1.00
R5010:Atg9a UTSW 1 75,162,704 (GRCm39) splice site probably null
R5220:Atg9a UTSW 1 75,162,372 (GRCm39) missense probably damaging 1.00
R5898:Atg9a UTSW 1 75,162,916 (GRCm39) missense probably damaging 1.00
R6390:Atg9a UTSW 1 75,164,625 (GRCm39) missense probably damaging 1.00
R7312:Atg9a UTSW 1 75,164,736 (GRCm39) missense probably damaging 1.00
R7729:Atg9a UTSW 1 75,161,204 (GRCm39) missense probably benign 0.34
R8111:Atg9a UTSW 1 75,164,366 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,163,009 (GRCm39) missense probably damaging 1.00
R8210:Atg9a UTSW 1 75,161,927 (GRCm39) missense probably damaging 1.00
R8256:Atg9a UTSW 1 75,163,563 (GRCm39) missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8321:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8382:Atg9a UTSW 1 75,162,342 (GRCm39) nonsense probably null
R8406:Atg9a UTSW 1 75,167,028 (GRCm39) missense probably damaging 1.00
R8482:Atg9a UTSW 1 75,162,870 (GRCm39) missense probably damaging 0.99
R8855:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R8866:Atg9a UTSW 1 75,161,867 (GRCm39) missense probably damaging 1.00
R9381:Atg9a UTSW 1 75,162,726 (GRCm39) missense probably benign
R9441:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9442:Atg9a UTSW 1 75,163,086 (GRCm39) missense possibly damaging 0.92
R9448:Atg9a UTSW 1 75,162,849 (GRCm39) missense probably benign 0.35
R9608:Atg9a UTSW 1 75,161,739 (GRCm39) missense possibly damaging 0.52
R9703:Atg9a UTSW 1 75,162,431 (GRCm39) missense probably damaging 0.98
RF021:Atg9a UTSW 1 75,159,273 (GRCm39) missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75,163,203 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAATAAGGCTCAGTGGC -3'
(R):5'- GAAGACCGAGTTGTCGCTCATG -3'

Sequencing Primer
(F):5'- GCTCAGTGGCTGTAGGAGG -3'
(R):5'- CGAGTTGTCGCTCATGCACTTTG -3'
Posted On 2018-04-02