Incidental Mutation 'R6295:Atg9a'
ID508688
Institutional Source Beutler Lab
Gene Symbol Atg9a
Ensembl Gene ENSMUSG00000033124
Gene Nameautophagy related 9A
SynonymsApg9l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location75180860-75192196 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 75185058 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 615 (S615P)
Ref Sequence ENSEMBL: ENSMUSP00000139641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027396] [ENSMUST00000040689] [ENSMUST00000188347] [ENSMUST00000189665] [ENSMUST00000189702]
Predicted Effect probably benign
Transcript: ENSMUST00000027396
SMART Domains Protein: ENSMUSP00000027396
Gene: ENSMUSG00000026198

DomainStartEndE-ValueType
Pfam:MTABC_N 6 255 7.8e-80 PFAM
Pfam:ABC_membrane 265 544 3.7e-34 PFAM
AAA 615 816 1.29e-19 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000040689
AA Change: S615P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000047449
Gene: ENSMUSG00000033124
AA Change: S615P

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 173 530 3.4e-134 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159219
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160081
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161103
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185727
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187601
Predicted Effect unknown
Transcript: ENSMUST00000187785
AA Change: S174P
Predicted Effect probably benign
Transcript: ENSMUST00000188347
AA Change: S615P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139731
Gene: ENSMUSG00000033124
AA Change: S615P

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000188430
Predicted Effect probably benign
Transcript: ENSMUST00000189665
SMART Domains Protein: ENSMUSP00000140012
Gene: ENSMUSG00000033124

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189702
AA Change: S615P

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000139641
Gene: ENSMUSG00000033124
AA Change: S615P

DomainStartEndE-ValueType
transmembrane domain 70 92 N/A INTRINSIC
transmembrane domain 126 148 N/A INTRINSIC
Pfam:APG9 172 533 2.4e-140 PFAM
low complexity region 588 599 N/A INTRINSIC
low complexity region 607 621 N/A INTRINSIC
Blast:HELICc 692 733 1e-13 BLAST
low complexity region 734 755 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000189820
AA Change: S607P
Meta Mutation Damage Score 0.0688 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a null mutation all die within 1 day of birth and display impaired autophagy. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Atg9a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01464:Atg9a APN 1 75190366 missense probably damaging 1.00
IGL02041:Atg9a APN 1 75183104 missense possibly damaging 0.47
IGL03367:Atg9a APN 1 75187957 missense probably benign 0.18
PIT4494001:Atg9a UTSW 1 75187953 nonsense probably null
R0054:Atg9a UTSW 1 75184499 missense probably damaging 1.00
R0054:Atg9a UTSW 1 75184499 missense probably damaging 1.00
R0408:Atg9a UTSW 1 75185295 missense probably damaging 1.00
R0520:Atg9a UTSW 1 75186534 nonsense probably null
R0653:Atg9a UTSW 1 75190328 missense probably damaging 0.96
R0666:Atg9a UTSW 1 75185090 missense probably damaging 0.99
R0961:Atg9a UTSW 1 75186746 missense probably damaging 0.99
R1489:Atg9a UTSW 1 75186090 missense probably damaging 1.00
R1490:Atg9a UTSW 1 75185745 missense possibly damaging 0.70
R1692:Atg9a UTSW 1 75190355 missense probably benign 0.04
R1997:Atg9a UTSW 1 75189626 missense probably benign 0.33
R2005:Atg9a UTSW 1 75185991 missense probably benign 0.18
R2172:Atg9a UTSW 1 75185685 missense probably damaging 0.99
R4004:Atg9a UTSW 1 75186451 missense probably damaging 1.00
R4105:Atg9a UTSW 1 75185959 missense probably damaging 1.00
R5010:Atg9a UTSW 1 75186060 unclassified probably null
R5220:Atg9a UTSW 1 75185728 missense probably damaging 1.00
R5898:Atg9a UTSW 1 75186272 missense probably damaging 1.00
R6390:Atg9a UTSW 1 75187981 missense probably damaging 1.00
R7312:Atg9a UTSW 1 75188092 missense probably damaging 1.00
R7729:Atg9a UTSW 1 75184560 missense probably benign 0.34
R8111:Atg9a UTSW 1 75187722 missense probably damaging 1.00
R8210:Atg9a UTSW 1 75185283 missense probably damaging 1.00
R8210:Atg9a UTSW 1 75186365 missense probably damaging 1.00
R8256:Atg9a UTSW 1 75186919 missense possibly damaging 0.88
R8319:Atg9a UTSW 1 75185698 nonsense probably null
R8321:Atg9a UTSW 1 75185698 nonsense probably null
RF021:Atg9a UTSW 1 75182629 missense probably damaging 0.96
Z1176:Atg9a UTSW 1 75186559 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCAATAAGGCTCAGTGGC -3'
(R):5'- GAAGACCGAGTTGTCGCTCATG -3'

Sequencing Primer
(F):5'- GCTCAGTGGCTGTAGGAGG -3'
(R):5'- CGAGTTGTCGCTCATGCACTTTG -3'
Posted On2018-04-02