Incidental Mutation 'R6295:Ptpn14'
ID508691
Institutional Source Beutler Lab
Gene Symbol Ptpn14
Ensembl Gene ENSMUSG00000026604
Gene Nameprotein tyrosine phosphatase, non-receptor type 14
SynonymsC130080N23Rik, PTP36, OTTMUSG00000022087
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location189728268-189876695 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 189850800 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 615 (P615S)
Ref Sequence ENSEMBL: ENSMUSP00000095051 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027898] [ENSMUST00000097442]
Predicted Effect probably benign
Transcript: ENSMUST00000027898
SMART Domains Protein: ENSMUSP00000027898
Gene: ENSMUSG00000026604

DomainStartEndE-ValueType
B41 17 220 3.7e-67 SMART
FERM_C 224 310 3.43e-15 SMART
low complexity region 565 575 N/A INTRINSIC
low complexity region 633 639 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
PTPc 910 1184 2.14e-103 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000097442
AA Change: P615S

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000095051
Gene: ENSMUSG00000026604
AA Change: P615S

DomainStartEndE-ValueType
B41 17 220 3.7e-67 SMART
FERM_C 224 310 3.43e-15 SMART
low complexity region 565 575 N/A INTRINSIC
low complexity region 633 639 N/A INTRINSIC
low complexity region 710 718 N/A INTRINSIC
low complexity region 745 758 N/A INTRINSIC
low complexity region 817 834 N/A INTRINSIC
PTPc 910 1184 2.14e-103 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000195038
Meta Mutation Damage Score 0.0717 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are known to be signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP contains an N-terminal noncatalytic domain similar to that of band 4.1 superfamily cytoskeleton-associated proteins, which suggested the membrane or cytoskeleton localization of this protein. It appears to regulate lymphatic development in mammals, and a loss of function mutation has been found in a kindred with a lymphedema-choanal atresia. [provided by RefSeq, Sep 2010]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit some postnatal growth retardation, decreased body weight, periorbital and limb edema, and lymphatic vessel hyperplasia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Ptpn14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01014:Ptpn14 APN 1 189822633 missense probably damaging 1.00
IGL02501:Ptpn14 APN 1 189850390 missense probably benign 0.14
IGL03011:Ptpn14 APN 1 189839557 missense probably damaging 1.00
R0724:Ptpn14 UTSW 1 189850947 missense possibly damaging 0.52
R0791:Ptpn14 UTSW 1 189836440 splice site probably benign
R1363:Ptpn14 UTSW 1 189798628 missense probably damaging 1.00
R1605:Ptpn14 UTSW 1 189865512 missense probably benign 0.00
R1840:Ptpn14 UTSW 1 189786851 missense probably damaging 1.00
R1845:Ptpn14 UTSW 1 189839502 missense possibly damaging 0.96
R1891:Ptpn14 UTSW 1 189798653 missense probably damaging 1.00
R2187:Ptpn14 UTSW 1 189863228 nonsense probably null
R2288:Ptpn14 UTSW 1 189865498 missense probably damaging 1.00
R3686:Ptpn14 UTSW 1 189851399 missense probably damaging 1.00
R3895:Ptpn14 UTSW 1 189850546 missense probably benign 0.31
R3898:Ptpn14 UTSW 1 189850531 missense probably benign 0.35
R4004:Ptpn14 UTSW 1 189850510 missense probably benign 0.00
R4816:Ptpn14 UTSW 1 189856800 missense probably damaging 1.00
R4883:Ptpn14 UTSW 1 189850800 missense probably damaging 0.99
R4928:Ptpn14 UTSW 1 189822642 missense probably damaging 1.00
R4931:Ptpn14 UTSW 1 189851277 missense probably benign
R4957:Ptpn14 UTSW 1 189851272 missense probably benign 0.02
R5009:Ptpn14 UTSW 1 189850534 missense probably benign
R5038:Ptpn14 UTSW 1 189786886 missense probably damaging 1.00
R5264:Ptpn14 UTSW 1 189832800 critical splice donor site probably null
R5373:Ptpn14 UTSW 1 189850963 missense probably benign
R5441:Ptpn14 UTSW 1 189798570 missense probably damaging 1.00
R5540:Ptpn14 UTSW 1 189846364 missense probably benign 0.05
R5638:Ptpn14 UTSW 1 189786841 missense probably damaging 1.00
R5746:Ptpn14 UTSW 1 189846413 critical splice donor site probably null
R5872:Ptpn14 UTSW 1 189851032 missense probably benign 0.00
R5988:Ptpn14 UTSW 1 189850387 missense probably damaging 1.00
R6139:Ptpn14 UTSW 1 189851165 missense probably benign 0.01
R6770:Ptpn14 UTSW 1 189832773 missense probably damaging 1.00
R7097:Ptpn14 UTSW 1 189863398 nonsense probably null
R7320:Ptpn14 UTSW 1 189832759 missense probably benign 0.11
R7324:Ptpn14 UTSW 1 189863424 missense possibly damaging 0.46
R7599:Ptpn14 UTSW 1 189850745 missense probably benign 0.39
R7699:Ptpn14 UTSW 1 189865411 missense probably benign 0.08
R7700:Ptpn14 UTSW 1 189865411 missense probably benign 0.08
Z1177:Ptpn14 UTSW 1 189860470 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTGAGCACTCCAGAACTAGC -3'
(R):5'- AGCCATGGGGATATTGAGTG -3'

Sequencing Primer
(F):5'- AACATGCAGCTCCAAGGAG -3'
(R):5'- AGTGACTTCAGTGTCATGGCCTC -3'
Posted On2018-04-02