Mutagenetix > Incidental Mutation

Incidental Mutation 'R6295:Ptgfr'

508698

Institutional Source

Beutler Lab

Gene Symbol

Ptgfr

Ensembl Gene

ENSMUSG00000028036

Gene Name

prostaglandin F receptor

Synonyms

FP, PGF

MMRRC Submission

044463-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.091) question?

Stock #

R6295 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

151504247-151543165 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 151540926 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Glutamic Acid to Glycine at position 194 (E194G)

Ref Sequence

ENSEMBL: ENSMUSP00000101732 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029670] [ENSMUST00000106126]

AlphaFold

P43117

Predicted Effect

probably benign
Transcript: ENSMUST00000029670
AA Change: E194G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000029670
Gene: ENSMUSG00000028036
AA Change: E194G

Domain	Start	End	E-Value	Type
Pfam:7tm_1	23	304	6.8e-18	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000106126
AA Change: E194G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000101732
Gene: ENSMUSG00000028036
AA Change: E194G

Domain	Start	End	E-Value	Type
Pfam:7tm_1	43	304	7.6e-26	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000128349

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000197392

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.7%

Validation Efficiency

98% (49/50)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the G-protein coupled receptor family. This protein is a receptor for prostaglandin F2-alpha (PGF2-alpha), which is known to be a potent luteolytic agent, and may also be involved in modulating intraocular pressure and smooth muscle contraction in uterus. Knockout studies in mice suggest that the interaction of PGF2-alpha with this receptor may initiate parturition in ovarian luteal cells and thus induce luteolysis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Pregnant females homozygous for a targeted null mutation are unable to deliver their offspring due to lack of induction of the oxytocin receptor and fail to show the normal decline of serum progesterone levels preceding parturition. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 50 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abcb5	A	C	12: 118,838,379 (GRCm39)	V1061G	probably damaging	Het
Acap1	A	G	11: 69,781,413 (GRCm39)		probably null	Het
Apbb1	A	G	7: 105,215,902 (GRCm39)	F112L	probably benign	Het
Atg9a	A	G	1: 75,161,702 (GRCm39)	S615P	probably benign	Het
Atp8a2	G	A	14: 60,249,848 (GRCm39)	R548*	probably null	Het
Bbof1	A	T	12: 84,457,942 (GRCm39)	N69I	possibly damaging	Het
Bcl2l14	T	A	6: 134,404,370 (GRCm39)	V186D	probably benign	Het
Bmp1	T	G	14: 70,728,823 (GRCm39)	Y583S	possibly damaging	Het
Boc	A	C	16: 44,312,711 (GRCm39)	S586R	probably benign	Het
Btbd9	A	T	17: 30,518,710 (GRCm39)		probably null	Het
Cacna1e	T	C	1: 154,317,919 (GRCm39)	M1180V	probably damaging	Het
Ciao1	T	C	2: 127,088,376 (GRCm39)	H149R	probably damaging	Het
Cops5	T	C	1: 10,100,920 (GRCm39)		probably benign	Het
Doc2b	C	T	11: 75,671,093 (GRCm39)	R209Q	probably damaging	Het
Doc2b	T	C	11: 75,686,451 (GRCm39)	Y90C	probably benign	Het
Ep400	A	G	5: 110,901,675 (GRCm39)	F481L	probably benign	Het
Fat4	T	A	3: 39,061,229 (GRCm39)		probably null	Het
Fbxw16	T	A	9: 109,277,837 (GRCm39)		probably benign	Het
Fbxw27	T	C	9: 109,601,154 (GRCm39)	E17G	possibly damaging	Het
Gm29735	G	A	7: 141,710,367 (GRCm39)	P162S	unknown	Het
Gypa	T	G	8: 81,222,969 (GRCm39)	S24R	unknown	Het
Hdhd5	T	C	6: 120,495,485 (GRCm39)	N153D	probably benign	Het
Ibsp	C	A	5: 104,449,987 (GRCm39)		probably null	Het
Klhdc3	C	T	17: 46,988,972 (GRCm39)	V73I	probably benign	Het
Lrrc37a	T	C	11: 103,388,459 (GRCm39)	E2322G	unknown	Het
Lrrtm3	T	C	10: 63,765,913 (GRCm39)	H558R	probably benign	Het
Mbtd1	C	T	11: 93,823,058 (GRCm39)	H493Y	possibly damaging	Het
Mphosph9	A	G	5: 124,458,978 (GRCm39)	V64A	possibly damaging	Het
Nthl1	C	T	17: 24,857,475 (GRCm39)	R251C	probably damaging	Het
Numa1	G	A	7: 101,649,974 (GRCm39)	R1235H	probably benign	Het
Opn1sw	T	A	6: 29,379,413 (GRCm39)	Y197F	possibly damaging	Het
Or10a3m	T	C	7: 108,312,845 (GRCm39)	V95A	probably damaging	Het
Pcca	A	T	14: 122,896,187 (GRCm39)	I268F	probably benign	Het
Per2	A	T	1: 91,377,594 (GRCm39)	D76E	unknown	Het
Pfas	T	C	11: 68,888,825 (GRCm39)	N374S	probably benign	Het
Pomk	C	A	8: 26,472,955 (GRCm39)	V333F	probably damaging	Het
Ptpn14	C	T	1: 189,582,997 (GRCm39)	P615S	probably damaging	Het
Pyroxd1	T	C	6: 142,300,479 (GRCm39)	I203T	probably benign	Het
Rgs22	T	C	15: 36,087,520 (GRCm39)	N466S	probably benign	Het
Rpl3l	G	A	17: 24,952,966 (GRCm39)	V309I	probably benign	Het
Rtkn2	C	T	10: 67,815,529 (GRCm39)		probably benign	Het
Sec16a	C	T	2: 26,318,253 (GRCm39)	A1613T	probably damaging	Het
Sis	T	A	3: 72,874,103 (GRCm39)	T33S	probably damaging	Het
Slc22a4	C	A	11: 53,898,634 (GRCm39)	V153F	possibly damaging	Het
Stxbp1	C	G	2: 32,684,621 (GRCm39)	E603Q	probably damaging	Het
Tiam2	A	G	17: 3,559,831 (GRCm39)	S1291G	probably damaging	Het
Tmem94	T	A	11: 115,687,572 (GRCm39)	L1144M	probably damaging	Het
Ttn	G	A	2: 76,579,673 (GRCm39)	T23740M	probably damaging	Het
Vmn1r201	T	C	13: 22,659,533 (GRCm39)	V249A	probably benign	Het
Wdr7	T	A	18: 63,888,182 (GRCm39)	C552S	probably damaging	Het

Other mutations in Ptgfr

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01322:Ptgfr	APN	3	151,541,323 (GRCm39)	missense	probably benign	0.43
IGL02085:Ptgfr	APN	3	151,541,437 (GRCm39)	missense	probably benign	0.00
IGL02110:Ptgfr	APN	3	151,541,097 (GRCm39)	missense	probably damaging	0.97
IGL02971:Ptgfr	APN	3	151,540,963 (GRCm39)	missense	probably benign	0.00
IGL03263:Ptgfr	APN	3	151,541,500 (GRCm39)	missense	probably benign	0.00
R0048:Ptgfr	UTSW	3	151,540,728 (GRCm39)	missense	possibly damaging	0.51
R0048:Ptgfr	UTSW	3	151,540,728 (GRCm39)	missense	possibly damaging	0.51
R0602:Ptgfr	UTSW	3	151,540,839 (GRCm39)	missense	probably damaging	1.00
R0624:Ptgfr	UTSW	3	151,540,839 (GRCm39)	missense	probably damaging	1.00
R0633:Ptgfr	UTSW	3	151,507,400 (GRCm39)	missense	probably benign	0.00
R1614:Ptgfr	UTSW	3	151,507,416 (GRCm39)	missense	probably benign	0.44
R1930:Ptgfr	UTSW	3	151,540,831 (GRCm39)	missense	probably benign	0.16
R1931:Ptgfr	UTSW	3	151,540,831 (GRCm39)	missense	probably benign	0.16
R1989:Ptgfr	UTSW	3	151,540,976 (GRCm39)	nonsense	probably null
R4596:Ptgfr	UTSW	3	151,507,430 (GRCm39)	missense	probably damaging	1.00
R5899:Ptgfr	UTSW	3	151,540,738 (GRCm39)	missense	probably damaging	0.96
R6907:Ptgfr	UTSW	3	151,540,938 (GRCm39)	missense	possibly damaging	0.95
R7047:Ptgfr	UTSW	3	151,541,178 (GRCm39)	missense	possibly damaging	0.74
R7320:Ptgfr	UTSW	3	151,541,034 (GRCm39)	missense	probably benign	0.22
R8205:Ptgfr	UTSW	3	151,541,418 (GRCm39)	missense	probably benign	0.04
R8420:Ptgfr	UTSW	3	151,541,053 (GRCm39)	missense	possibly damaging	0.49
R9049:Ptgfr	UTSW	3	151,541,404 (GRCm39)	missense	probably benign	0.24
R9352:Ptgfr	UTSW	3	151,541,160 (GRCm39)	missense	probably damaging	1.00
R9537:Ptgfr	UTSW	3	151,541,445 (GRCm39)	missense	possibly damaging	0.91
Z1176:Ptgfr	UTSW	3	151,541,278 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AGGAGACGCACATTATGGCC -3'
(R):5'- TTTCTAGGCAGTGCGATGGC -3'

Sequencing Primer
(F):5'- GCCAGGAGCTGAATGATCATCTC -3'
(R):5'- CCATCGAGAGGTGTATAGGAGTCAC -3'

Posted On

2018-04-02