Incidental Mutation 'R6295:Ptgfr'
ID508698
Institutional Source Beutler Lab
Gene Symbol Ptgfr
Ensembl Gene ENSMUSG00000028036
Gene Nameprostaglandin F receptor
SynonymsFP, PGF
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.138) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location151796502-151837630 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 151835289 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 194 (E194G)
Ref Sequence ENSEMBL: ENSMUSP00000101732 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029670] [ENSMUST00000106126]
Predicted Effect probably benign
Transcript: ENSMUST00000029670
AA Change: E194G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000029670
Gene: ENSMUSG00000028036
AA Change: E194G

DomainStartEndE-ValueType
Pfam:7tm_1 23 304 6.8e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106126
AA Change: E194G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000101732
Gene: ENSMUSG00000028036
AA Change: E194G

DomainStartEndE-ValueType
Pfam:7tm_1 43 304 7.6e-26 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128349
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197392
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is member of the G-protein coupled receptor family. This protein is a receptor for prostaglandin F2-alpha (PGF2-alpha), which is known to be a potent luteolytic agent, and may also be involved in modulating intraocular pressure and smooth muscle contraction in uterus. Knockout studies in mice suggest that the interaction of PGF2-alpha with this receptor may initiate parturition in ovarian luteal cells and thus induce luteolysis. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Pregnant females homozygous for a targeted null mutation are unable to deliver their offspring due to lack of induction of the oxytocin receptor and fail to show the normal decline of serum progesterone levels preceding parturition. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Ptgfr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01322:Ptgfr APN 3 151835686 missense probably benign 0.43
IGL02085:Ptgfr APN 3 151835800 missense probably benign 0.00
IGL02110:Ptgfr APN 3 151835460 missense probably damaging 0.97
IGL02971:Ptgfr APN 3 151835326 missense probably benign 0.00
IGL03263:Ptgfr APN 3 151835863 missense probably benign 0.00
R0048:Ptgfr UTSW 3 151835091 missense possibly damaging 0.51
R0048:Ptgfr UTSW 3 151835091 missense possibly damaging 0.51
R0602:Ptgfr UTSW 3 151835202 missense probably damaging 1.00
R0624:Ptgfr UTSW 3 151835202 missense probably damaging 1.00
R0633:Ptgfr UTSW 3 151801763 missense probably benign 0.00
R1614:Ptgfr UTSW 3 151801779 missense probably benign 0.44
R1930:Ptgfr UTSW 3 151835194 missense probably benign 0.16
R1931:Ptgfr UTSW 3 151835194 missense probably benign 0.16
R1989:Ptgfr UTSW 3 151835339 nonsense probably null
R4596:Ptgfr UTSW 3 151801793 missense probably damaging 1.00
R5899:Ptgfr UTSW 3 151835101 missense probably damaging 0.96
R6907:Ptgfr UTSW 3 151835301 missense possibly damaging 0.95
R7047:Ptgfr UTSW 3 151835541 missense possibly damaging 0.74
R7320:Ptgfr UTSW 3 151835397 missense probably benign 0.22
R8205:Ptgfr UTSW 3 151835781 missense probably benign 0.04
Z1176:Ptgfr UTSW 3 151835641 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGAGACGCACATTATGGCC -3'
(R):5'- TTTCTAGGCAGTGCGATGGC -3'

Sequencing Primer
(F):5'- GCCAGGAGCTGAATGATCATCTC -3'
(R):5'- CCATCGAGAGGTGTATAGGAGTCAC -3'
Posted On2018-04-02