Incidental Mutation 'R6295:Opn1sw'
ID508701
Institutional Source Beutler Lab
Gene Symbol Opn1sw
Ensembl Gene ENSMUSG00000058831
Gene Nameopsin 1 (cone pigments), short-wave-sensitive (color blindness, tritan)
SynonymsBlue/UV Opsin, Bcp, UV cone pigment, Blue Opsin, SWS opsin, Short Wavelength Sensitive opsin, S Opsin, Blue Cone Opsin
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.064) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location29376671-29388468 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 29379414 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 197 (Y197F)
Ref Sequence ENSEMBL: ENSMUSP00000133745 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031779] [ENSMUST00000080428] [ENSMUST00000090481] [ENSMUST00000147483] [ENSMUST00000172974] [ENSMUST00000173216] [ENSMUST00000173653] [ENSMUST00000173694] [ENSMUST00000174096]
Predicted Effect probably benign
Transcript: ENSMUST00000031779
SMART Domains Protein: ENSMUSP00000031779
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.1e1 SMART
Blast:EFh 108 136 3e-11 BLAST
EFh 155 183 9.61e1 SMART
EFh 192 220 2.03e-2 SMART
Blast:EFh 233 261 2e-10 BLAST
EFh 269 297 5.75e1 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000080428
AA Change: Y197F

PolyPhen 2 Score 0.840 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079289
Gene: ENSMUSG00000058831
AA Change: Y197F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srv 41 318 4e-9 PFAM
Pfam:7tm_1 49 301 2.5e-43 PFAM
Pfam:7tm_4 188 319 6.2e-8 PFAM
low complexity region 330 343 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000090481
SMART Domains Protein: ENSMUSP00000087967
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.82e0 SMART
EFh 108 136 2.44e1 SMART
EFh 155 183 9.61e1 SMART
EFh 192 220 2.03e-2 SMART
Blast:EFh 233 261 2e-10 BLAST
EFh 269 297 5.75e1 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138523
Predicted Effect possibly damaging
Transcript: ENSMUST00000147483
AA Change: Y197F

PolyPhen 2 Score 0.903 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000133745
Gene: ENSMUSG00000058831
AA Change: Y197F

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 40 250 9.2e-7 PFAM
Pfam:7TM_GPCR_Srv 41 254 1.8e-6 PFAM
Pfam:7tm_1 49 271 1.9e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000172607
SMART Domains Protein: ENSMUSP00000133609
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
Blast:EFh 2 20 1e-5 BLAST
SCOP:d2mysb_ 2 51 6e-5 SMART
Blast:EFh 28 56 2e-12 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172974
SMART Domains Protein: ENSMUSP00000133390
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 1.1e1 SMART
Blast:EFh 108 136 1e-11 BLAST
EFh 155 183 9.61e1 SMART
EFh 192 220 1.41e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173216
SMART Domains Protein: ENSMUSP00000134708
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
EFh 3 31 9.61e1 SMART
EFh 40 68 2.03e-2 SMART
Blast:EFh 81 109 2e-11 BLAST
EFh 117 145 5.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173653
AA Change: Y48F

PolyPhen 2 Score 0.198 (Sensitivity: 0.92; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000133534
Gene: ENSMUSG00000058831
AA Change: Y48F

DomainStartEndE-ValueType
Pfam:7tm_1 1 61 6.6e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173694
SMART Domains Protein: ENSMUSP00000133436
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
EFh 72 100 5.38e0 SMART
EFh 108 136 5.75e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000174096
SMART Domains Protein: ENSMUSP00000133945
Gene: ENSMUSG00000029767

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:EF-hand_7 43 97 5.3e-8 PFAM
Pfam:EF-hand_6 72 101 6.5e-5 PFAM
Pfam:EF-hand_7 72 133 5e-12 PFAM
Pfam:EF-hand_5 73 98 4.5e-5 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene belongs to the G-protein coupled receptor 1 family, opsin subfamily. It encodes the blue cone pigment gene which is one of three types of cone photoreceptors responsible for normal color vision. Defects in this gene are the cause of tritan color blindness (tritanopia). Affected individuals lack blue and yellow sensory mechanisms while retaining those for red and green. Defective blue vision is characteristic. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-in allele exhibit abnormal cone physiology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Opn1sw
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03157:Opn1sw APN 6 29379804 missense possibly damaging 0.88
R0550:Opn1sw UTSW 6 29380204 missense probably damaging 1.00
R1533:Opn1sw UTSW 6 29378924 missense probably benign 0.36
R1902:Opn1sw UTSW 6 29379804 missense possibly damaging 0.88
R4085:Opn1sw UTSW 6 29380144 missense possibly damaging 0.89
R4418:Opn1sw UTSW 6 29379424 nonsense probably null
R4812:Opn1sw UTSW 6 29378039 missense probably damaging 0.99
R5692:Opn1sw UTSW 6 29379841 unclassified probably benign
R5839:Opn1sw UTSW 6 29379830 missense probably damaging 1.00
R5915:Opn1sw UTSW 6 29379755 unclassified probably null
R6045:Opn1sw UTSW 6 29379870 missense probably damaging 1.00
R6784:Opn1sw UTSW 6 29379847 missense probably damaging 1.00
R7259:Opn1sw UTSW 6 29378912 missense probably benign
R7315:Opn1sw UTSW 6 29379363 missense probably damaging 1.00
R7412:Opn1sw UTSW 6 29379857 missense probably damaging 1.00
R7749:Opn1sw UTSW 6 29380169 missense probably benign 0.00
Z1176:Opn1sw UTSW 6 29379456 missense probably damaging 1.00
Z1177:Opn1sw UTSW 6 29380344 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CTGACCACGGATATTCTAGACG -3'
(R):5'- CGCTGGAGACATCAATGGTTAC -3'

Sequencing Primer
(F):5'- CACGGATATTCTAGACGTATCCTGAG -3'
(R):5'- GGAGACATCAATGGTTACTCTGCC -3'
Posted On2018-04-02