Incidental Mutation 'R6295:Bcl2l14'
List |< first << previous [record 7 of 51] next >> last >|
ID508703
Institutional Source Beutler Lab
Gene Symbol Bcl2l14
Ensembl Gene ENSMUSG00000030200
Gene NameBCL2-like 14 (apoptosis facilitator)
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.091) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location134396318-134438736 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 134427407 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 186 (V186D)
Ref Sequence ENSEMBL: ENSMUSP00000132525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032321] [ENSMUST00000111960] [ENSMUST00000127865] [ENSMUST00000163589]
Predicted Effect probably benign
Transcript: ENSMUST00000032321
AA Change: V186D

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000032321
Gene: ENSMUSG00000030200
AA Change: V186D

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000111960
AA Change: V186D

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000107591
Gene: ENSMUSG00000030200
AA Change: V186D

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000127865
SMART Domains Protein: ENSMUSP00000115608
Gene: ENSMUSG00000030200

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142612
Predicted Effect probably benign
Transcript: ENSMUST00000163589
AA Change: V186D

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132525
Gene: ENSMUSG00000030200
AA Change: V186D

DomainStartEndE-ValueType
low complexity region 8 19 N/A INTRINSIC
SCOP:d1maz__ 200 320 5e-23 SMART
Blast:BCL 217 316 4e-43 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205104
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the BCL2 protein family. BCL2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. Overexpression of this gene has been shown to induce apoptosis in cells. Three alternatively spliced transcript variants encoding two distinct isoforms have been reported for this gene. [provided by RefSeq, May 2009]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Bcl2l14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01359:Bcl2l14 APN 6 134423865 missense probably damaging 1.00
IGL02451:Bcl2l14 APN 6 134423841 missense probably benign 0.18
R1115:Bcl2l14 UTSW 6 134432139 splice site probably benign
R1482:Bcl2l14 UTSW 6 134427302 missense probably damaging 1.00
R1952:Bcl2l14 UTSW 6 134432366 missense probably damaging 1.00
R3932:Bcl2l14 UTSW 6 134423808 missense probably damaging 0.98
R3933:Bcl2l14 UTSW 6 134423808 missense probably damaging 0.98
R5772:Bcl2l14 UTSW 6 134427399 missense probably damaging 0.98
R7078:Bcl2l14 UTSW 6 134423823 missense probably damaging 0.98
R7496:Bcl2l14 UTSW 6 134427454 missense probably benign 0.00
R7785:Bcl2l14 UTSW 6 134432260 missense possibly damaging 0.96
R7792:Bcl2l14 UTSW 6 134432314 missense possibly damaging 0.84
X0062:Bcl2l14 UTSW 6 134427371 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTCCTTTTATCTGAGGCTGGCC -3'
(R):5'- CATCGTGTTGCCTTCAAGTGG -3'

Sequencing Primer
(F):5'- AGGCTGGCCTCTTCATCCTAAAC -3'
(R):5'- GGCTGAGATTCCCAATTTGCAGAG -3'
Posted On2018-04-02