Incidental Mutation 'R6295:Olfr512'
ID508707
Institutional Source Beutler Lab
Gene Symbol Olfr512
Ensembl Gene ENSMUSG00000056946
Gene Nameolfactory receptor 512
SynonymsMOR268-3, GA_x6K02T2PBJ9-11043421-11044365
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location108713320-108714375 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108713638 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 95 (V95A)
Ref Sequence ENSEMBL: ENSMUSP00000074291 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074730] [ENSMUST00000209620]
Predicted Effect probably damaging
Transcript: ENSMUST00000074730
AA Change: V95A

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000074291
Gene: ENSMUSG00000056946
AA Change: V95A

DomainStartEndE-ValueType
Pfam:7tm_4 43 320 7.8e-62 PFAM
Pfam:7TM_GPCR_Srsx 47 317 2.5e-6 PFAM
Pfam:7tm_1 53 302 2.3e-25 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000209620
AA Change: V83A

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
Meta Mutation Damage Score 0.2606 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Olfr512
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01889:Olfr512 APN 7 108713882 missense probably benign 0.02
IGL01912:Olfr512 APN 7 108714258 missense possibly damaging 0.60
IGL02182:Olfr512 APN 7 108713868 missense probably benign 0.02
IGL02409:Olfr512 APN 7 108714159 missense probably benign 0.00
IGL02554:Olfr512 APN 7 108713742 missense possibly damaging 0.94
IGL03210:Olfr512 APN 7 108713568 missense probably damaging 1.00
IGL03373:Olfr512 APN 7 108714132 missense probably damaging 1.00
IGL03400:Olfr512 APN 7 108713526 missense probably benign 0.28
R0092:Olfr512 UTSW 7 108713824 missense probably benign
R0741:Olfr512 UTSW 7 108713604 missense probably benign 0.00
R1515:Olfr512 UTSW 7 108713941 missense possibly damaging 0.94
R1982:Olfr512 UTSW 7 108713695 missense probably damaging 1.00
R2176:Olfr512 UTSW 7 108714132 missense probably damaging 1.00
R3967:Olfr512 UTSW 7 108713853 missense probably benign
R4009:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R4010:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R4011:Olfr512 UTSW 7 108714159 missense probably benign 0.00
R5095:Olfr512 UTSW 7 108713812 missense probably damaging 1.00
R5271:Olfr512 UTSW 7 108714217 missense probably damaging 1.00
R5864:Olfr512 UTSW 7 108713464 missense probably benign
R5926:Olfr512 UTSW 7 108713587 missense probably damaging 1.00
R6528:Olfr512 UTSW 7 108713431 missense probably damaging 1.00
R6624:Olfr512 UTSW 7 108713536 missense possibly damaging 0.50
R8029:Olfr512 UTSW 7 108713830 missense possibly damaging 0.70
X0023:Olfr512 UTSW 7 108714010 missense possibly damaging 0.79
Z1088:Olfr512 UTSW 7 108713538 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CCTGAACTTCAAGATCAGATGTTTGG -3'
(R):5'- TGGTACCTGAGACCCATGAG -3'

Sequencing Primer
(F):5'- CAAGATCAGATGTTTGGGACTTTCC -3'
(R):5'- GTACCTGAGACCCATGAGAACATAAC -3'
Posted On2018-04-02