Incidental Mutation 'R6295:Pomk'
ID508709
Institutional Source Beutler Lab
Gene Symbol Pomk
Ensembl Gene ENSMUSG00000037251
Gene Nameprotein-O-mannose kinase
SynonymsSgk196, 4930444A02Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.235) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location25980604-25994133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 25982927 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 333 (V333F)
Ref Sequence ENSEMBL: ENSMUSP00000053802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061850]
Predicted Effect probably damaging
Transcript: ENSMUST00000061850
AA Change: V333F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000053802
Gene: ENSMUSG00000037251
AA Change: V333F

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Pkinase 80 207 2e-6 PFAM
Pfam:Pkinase_Tyr 80 215 5.9e-11 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that may be involved in the presentation of the laminin-binding O-linked carbohydrate chain of alpha-dystroglycan (a-DG), which forms transmembrane linkages between the extracellular matrix and the exoskeleton. Some pathogens use this O-linked carbohydrate unit for host entry. Loss of function compound heterozygous mutations in this gene were found in a human patient affected by the Walker-Warburg syndrome (WWS) phenotype. Mice lacking this gene contain misplaced neurons (heterotopia) in some regions of the brain, possibly from defects in neuronal migration. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap insertion show hydrocephaly and cerebellar dysplasia. Mice also show learning defects, impaired motor strength and decreased sensitivity to pain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Pomk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Pomk APN 8 25983596 missense probably benign 0.21
IGL02678:Pomk APN 8 25983107 missense probably damaging 0.97
IGL03090:Pomk APN 8 25983310 missense probably damaging 0.99
R1302:Pomk UTSW 8 25983074 missense probably damaging 1.00
R3105:Pomk UTSW 8 25982914 missense probably damaging 1.00
R4646:Pomk UTSW 8 25983605 missense probably damaging 1.00
R5106:Pomk UTSW 8 25986376 missense probably benign 0.00
R5343:Pomk UTSW 8 25983016 missense probably benign 0.09
R5572:Pomk UTSW 8 25983190 missense possibly damaging 0.88
R5953:Pomk UTSW 8 25983048 missense probably damaging 1.00
R6150:Pomk UTSW 8 25983256 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TCAAACATGCAGGCAGACG -3'
(R):5'- GCCCTTCCAAGACGATCTCATG -3'

Sequencing Primer
(F):5'- CAGACGTAGAGGAGGCCTAC -3'
(R):5'- GCCTTCCTACAATGAGAAGGTTGAC -3'
Posted On2018-04-02