Incidental Mutation 'R6295:Gypa'
ID508710
Institutional Source Beutler Lab
Gene Symbol Gypa
Ensembl Gene ENSMUSG00000051839
Gene Nameglycophorin A
SynonymsCD235a, GPA
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location80493781-80510542 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 80496340 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 24 (S24R)
Ref Sequence ENSEMBL: ENSMUSP00000070836 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063359]
Predicted Effect unknown
Transcript: ENSMUST00000063359
AA Change: S24R
SMART Domains Protein: ENSMUSP00000070836
Gene: ENSMUSG00000051839
AA Change: S24R

DomainStartEndE-ValueType
Pfam:Glycophorin_A 43 162 2.5e-53 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype PHENOTYPE: Mice homozygous for a targeted null mutation are viable and fertile; however, mutant erythrocytes had a reduced percentage of O-linked glycoproteins in the membranes, and were sensitive to hypoosmotic stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Gypa
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00232:Gypa APN 8 80504779 splice site probably benign
IGL02283:Gypa APN 8 80494092 splice site probably benign
R0067:Gypa UTSW 8 80503081 missense possibly damaging 0.71
R0094:Gypa UTSW 8 80500931 missense unknown
R0563:Gypa UTSW 8 80509460 missense probably benign 0.04
R0685:Gypa UTSW 8 80496702 splice site probably benign
R0729:Gypa UTSW 8 80496792 missense unknown
R0850:Gypa UTSW 8 80496345 missense unknown
R1299:Gypa UTSW 8 80496753 missense unknown
R2435:Gypa UTSW 8 80506768 splice site probably null
R4998:Gypa UTSW 8 80496335 missense unknown
R5121:Gypa UTSW 8 80496348 missense unknown
R6827:Gypa UTSW 8 80504788 missense probably benign 0.00
R8171:Gypa UTSW 8 80509463 missense probably benign 0.09
R8200:Gypa UTSW 8 80494066 missense unknown
Z1177:Gypa UTSW 8 80500998 missense unknown
Predicted Primers PCR Primer
(F):5'- GTCTCCACAATGTTGCGACAG -3'
(R):5'- CACCTCCAGTTACGATGGTTAC -3'

Sequencing Primer
(F):5'- ATTGCAGCTCCAGTCTTAAGG -3'
(R):5'- TGGCAGGAGATCCTCTAGAGC -3'
Posted On2018-04-02