Incidental Mutation 'R6295:Lrrtm3'
ID508712
Institutional Source Beutler Lab
Gene Symbol Lrrtm3
Ensembl Gene ENSMUSG00000042846
Gene Nameleucine rich repeat transmembrane neuronal 3
Synonyms9630044H04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location63928472-64090277 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 63930134 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 558 (H558R)
Ref Sequence ENSEMBL: ENSMUSP00000101079 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075099] [ENSMUST00000079279] [ENSMUST00000105439] [ENSMUST00000105440] [ENSMUST00000105441]
Predicted Effect probably benign
Transcript: ENSMUST00000075099
SMART Domains Protein: ENSMUSP00000074606
Gene: ENSMUSG00000060843

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079279
Predicted Effect probably benign
Transcript: ENSMUST00000105439
AA Change: H558R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000101079
Gene: ENSMUSG00000042846
AA Change: H558R

DomainStartEndE-ValueType
low complexity region 13 27 N/A INTRINSIC
LRRNT 33 65 2.11e-3 SMART
LRR_TYP 84 107 2.09e-3 SMART
LRR 108 131 6.77e0 SMART
LRR_TYP 132 155 2.71e-2 SMART
LRR_TYP 156 179 1.47e-3 SMART
LRR 180 203 1.43e-1 SMART
LRR 204 227 1.29e1 SMART
LRR 228 251 2.14e1 SMART
LRR 252 276 1.45e1 SMART
LRR 277 300 2.02e-1 SMART
Blast:LRRCT 312 361 6e-16 BLAST
transmembrane domain 421 443 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000105440
SMART Domains Protein: ENSMUSP00000101080
Gene: ENSMUSG00000060843

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105441
SMART Domains Protein: ENSMUSP00000101081
Gene: ENSMUSG00000060843

DomainStartEndE-ValueType
Pfam:Vinculin 17 363 5.1e-66 PFAM
Pfam:Vinculin 324 856 1e-175 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135474
Meta Mutation Damage Score 0.0704 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Lrrtm3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00743:Lrrtm3 APN 10 64089209 missense probably damaging 1.00
IGL02026:Lrrtm3 APN 10 64088452 missense probably damaging 1.00
IGL02452:Lrrtm3 APN 10 64088036 missense probably damaging 0.98
IGL03145:Lrrtm3 APN 10 64089020 missense probably benign 0.00
R1511:Lrrtm3 UTSW 10 64089025 missense probably damaging 1.00
R1556:Lrrtm3 UTSW 10 64088149 missense probably damaging 0.97
R1921:Lrrtm3 UTSW 10 64088378 missense probably benign 0.37
R1933:Lrrtm3 UTSW 10 64088513 missense possibly damaging 0.81
R2849:Lrrtm3 UTSW 10 64089031 missense probably damaging 1.00
R4707:Lrrtm3 UTSW 10 64088002 missense probably benign 0.42
R4785:Lrrtm3 UTSW 10 64088002 missense probably benign 0.42
R5423:Lrrtm3 UTSW 10 64088152 missense possibly damaging 0.81
R5559:Lrrtm3 UTSW 10 63930266 missense probably benign 0.35
R6301:Lrrtm3 UTSW 10 64089222 missense probably benign 0.26
R6356:Lrrtm3 UTSW 10 63930164 missense probably benign 0.13
R6799:Lrrtm3 UTSW 10 64087851 nonsense probably null
R7419:Lrrtm3 UTSW 10 64088146 missense probably damaging 1.00
R7494:Lrrtm3 UTSW 10 64089179 missense probably damaging 1.00
R7694:Lrrtm3 UTSW 10 64088039 missense probably benign 0.03
R7723:Lrrtm3 UTSW 10 64088648 missense possibly damaging 0.69
Z1176:Lrrtm3 UTSW 10 64089355 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCACAACTTAGCTAGTTACAAAGTA -3'
(R):5'- TTGATAACTGACTTTTCTCATGTCATC -3'

Sequencing Primer
(F):5'- GAATTTTGTTTATTTGAACAGGGGAG -3'
(R):5'- AGTTACTGTGGGGTCCAT -3'
Posted On2018-04-02