Incidental Mutation 'R6295:Slc22a4'
ID508714
Institutional Source Beutler Lab
Gene Symbol Slc22a4
Ensembl Gene ENSMUSG00000020334
Gene Namesolute carrier family 22 (organic cation transporter), member 4
SynonymsOctn1
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.340) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location53983123-54028090 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 54007808 bp
ZygosityHeterozygous
Amino Acid Change Valine to Phenylalanine at position 153 (V153F)
Ref Sequence ENSEMBL: ENSMUSP00000020586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020586]
Predicted Effect possibly damaging
Transcript: ENSMUST00000020586
AA Change: V153F

PolyPhen 2 Score 0.455 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000020586
Gene: ENSMUSG00000020334
AA Change: V153F

DomainStartEndE-ValueType
transmembrane domain 20 42 N/A INTRINSIC
Pfam:Sugar_tr 60 524 2.7e-30 PFAM
Pfam:MFS_1 139 478 1.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146351
Meta Mutation Damage Score 0.1795 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Polyspecific organic cation transporters in the liver, kidney, intestine, and other organs are critical for elimination of many endogenous small organic cations as well as a wide array of drugs and environmental toxins. The encoded protein is an organic cation transporter and plasma integral membrane protein containing eleven putative transmembrane domains as well as a nucleotide-binding site motif. Transport by this protein is at least partially ATP-dependent. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit complete loss of ergothioneine with reduced absorption and increased excretion and increased susceptibility of small intestine to inflammation following ischemia and reperfusion. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Slc22a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01459:Slc22a4 APN 11 53986477 critical splice donor site probably null
IGL01723:Slc22a4 APN 11 53988845 missense probably benign 0.28
IGL01839:Slc22a4 APN 11 53996077 missense probably damaging 0.98
IGL02022:Slc22a4 APN 11 53983609 unclassified probably benign
IGL02386:Slc22a4 APN 11 53988772 splice site probably benign
PIT1430001:Slc22a4 UTSW 11 54027957 missense probably benign
R0001:Slc22a4 UTSW 11 54028003 start gained probably benign
R1111:Slc22a4 UTSW 11 54007841 missense probably benign
R1710:Slc22a4 UTSW 11 54027975 start codon destroyed probably null 0.99
R2104:Slc22a4 UTSW 11 53983610 unclassified probably benign
R3081:Slc22a4 UTSW 11 54007789 missense probably benign 0.38
R3498:Slc22a4 UTSW 11 53992053 missense probably benign 0.00
R4014:Slc22a4 UTSW 11 53997392 missense probably benign 0.04
R4658:Slc22a4 UTSW 11 53997510 missense probably benign 0.05
R4720:Slc22a4 UTSW 11 53988893 missense probably damaging 1.00
R4727:Slc22a4 UTSW 11 54027651 missense possibly damaging 0.83
R5894:Slc22a4 UTSW 11 53997515 missense probably benign 0.04
R5945:Slc22a4 UTSW 11 53996028 missense probably damaging 1.00
R6848:Slc22a4 UTSW 11 54007789 missense possibly damaging 0.90
R6899:Slc22a4 UTSW 11 53988913 missense probably damaging 1.00
R7343:Slc22a4 UTSW 11 53986538 missense possibly damaging 0.53
R7414:Slc22a4 UTSW 11 53997428 missense probably benign 0.00
R7806:Slc22a4 UTSW 11 53990650 missense probably damaging 1.00
R8068:Slc22a4 UTSW 11 53997443 missense possibly damaging 0.89
R8087:Slc22a4 UTSW 11 53996061 missense possibly damaging 0.80
Z1177:Slc22a4 UTSW 11 54027718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTCTCAGCCCTAGCATCCCAAG -3'
(R):5'- TGTACCTTTTGCACAGAGCC -3'

Sequencing Primer
(F):5'- TAGCATCCCAAGCGCTAGG -3'
(R):5'- TTTTGCACAGAGCCAGCCTG -3'
Posted On2018-04-02