Incidental Mutation 'R6295:Acap1'
ID508716
Institutional Source Beutler Lab
Gene Symbol Acap1
Ensembl Gene ENSMUSG00000001588
Gene NameArfGAP with coiled-coil, ankyrin repeat and PH domains 1
SynonymsCentb1
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location69881567-69895539 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 69890587 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000001631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001631] [ENSMUST00000001631] [ENSMUST00000108622]
Predicted Effect probably null
Transcript: ENSMUST00000001631
SMART Domains Protein: ENSMUSP00000001631
Gene: ENSMUSG00000001588

DomainStartEndE-ValueType
Pfam:BAR_3 5 240 2.1e-68 PFAM
PH 266 362 4.42e-15 SMART
ArfGap 405 527 2.42e-50 SMART
ANK 606 635 4.01e0 SMART
ANK 639 668 3.04e0 SMART
ANK 672 702 4.18e2 SMART
Predicted Effect probably null
Transcript: ENSMUST00000001631
SMART Domains Protein: ENSMUSP00000001631
Gene: ENSMUSG00000001588

DomainStartEndE-ValueType
Pfam:BAR_3 5 240 2.1e-68 PFAM
PH 266 362 4.42e-15 SMART
ArfGap 405 527 2.42e-50 SMART
ANK 606 635 4.01e0 SMART
ANK 639 668 3.04e0 SMART
ANK 672 702 4.18e2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108622
SMART Domains Protein: ENSMUSP00000104262
Gene: ENSMUSG00000001588

DomainStartEndE-ValueType
PH 78 174 4.42e-15 SMART
ArfGap 217 339 2.42e-50 SMART
ANK 418 447 4.01e0 SMART
ANK 451 480 3.04e0 SMART
ANK 484 514 4.18e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148037
Meta Mutation Damage Score 0.9493 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rpl3l G A 17: 24,733,992 V309I probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Acap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00325:Acap1 APN 11 69882691 missense possibly damaging 0.95
IGL01148:Acap1 APN 11 69890903 nonsense probably null
IGL01398:Acap1 APN 11 69881722 missense probably damaging 1.00
IGL01583:Acap1 APN 11 69881677 missense probably damaging 1.00
IGL02002:Acap1 APN 11 69884460 missense probably damaging 1.00
IGL02078:Acap1 APN 11 69895286 missense probably damaging 1.00
IGL02083:Acap1 APN 11 69889510 missense possibly damaging 0.74
IGL02535:Acap1 APN 11 69882694 missense probably benign 0.02
IGL02669:Acap1 APN 11 69894595 unclassified probably benign
IGL03125:Acap1 APN 11 69887038 missense probably damaging 1.00
autobot UTSW 11 69881722 missense probably damaging 1.00
R0127:Acap1 UTSW 11 69887217 splice site probably benign
R0243:Acap1 UTSW 11 69885426 missense probably damaging 0.98
R0604:Acap1 UTSW 11 69884625 missense probably benign 0.01
R0863:Acap1 UTSW 11 69887056 missense probably damaging 0.98
R1331:Acap1 UTSW 11 69882376 splice site probably null
R1911:Acap1 UTSW 11 69881722 missense probably damaging 1.00
R1994:Acap1 UTSW 11 69889498 missense probably benign 0.41
R2411:Acap1 UTSW 11 69885485 missense probably damaging 1.00
R2442:Acap1 UTSW 11 69889491 missense possibly damaging 0.46
R2910:Acap1 UTSW 11 69887076 splice site probably benign
R4164:Acap1 UTSW 11 69890037 missense probably benign 0.22
R4223:Acap1 UTSW 11 69883685 missense probably damaging 0.99
R4562:Acap1 UTSW 11 69885351 intron probably benign
R4676:Acap1 UTSW 11 69889468 missense probably benign 0.22
R4852:Acap1 UTSW 11 69884376 missense probably benign 0.30
R4921:Acap1 UTSW 11 69887193 missense probably damaging 0.98
R4928:Acap1 UTSW 11 69885815 missense possibly damaging 0.81
R5536:Acap1 UTSW 11 69889307 missense probably benign 0.11
R5886:Acap1 UTSW 11 69884336 missense probably benign
R6053:Acap1 UTSW 11 69887070 critical splice acceptor site probably null
R6196:Acap1 UTSW 11 69887067 missense probably damaging 0.98
R6220:Acap1 UTSW 11 69889679 missense probably damaging 0.99
R6333:Acap1 UTSW 11 69883601 missense possibly damaging 0.65
R6414:Acap1 UTSW 11 69884336 missense probably benign
R6848:Acap1 UTSW 11 69884661 missense probably damaging 1.00
R6952:Acap1 UTSW 11 69885517 missense probably benign 0.30
R7243:Acap1 UTSW 11 69890471 missense probably benign 0.21
R8066:Acap1 UTSW 11 69889863 missense probably benign 0.05
X0012:Acap1 UTSW 11 69881689 missense probably damaging 1.00
X0027:Acap1 UTSW 11 69881723 missense probably damaging 1.00
Z1177:Acap1 UTSW 11 69882443 missense probably benign
Predicted Primers PCR Primer
(F):5'- GGATAAGGCCCCTCTTTCCC -3'
(R):5'- ACTTCGGTAGAGGAGGACTG -3'

Sequencing Primer
(F):5'- CTCCCGTCTCACTCCTTGAC -3'
(R):5'- GTCTGCAGAGCCCAGAAC -3'
Posted On2018-04-02