Incidental Mutation 'R6295:Rpl3l'
ID508731
Institutional Source Beutler Lab
Gene Symbol Rpl3l
Ensembl Gene ENSMUSG00000002500
Gene Nameribosomal protein L3-like
Synonyms1110057H16Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.127) question?
Stock #R6295 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location24727820-24736143 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 24733992 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 309 (V309I)
Ref Sequence ENSEMBL: ENSMUSP00000129325 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045186] [ENSMUST00000101800] [ENSMUST00000115262] [ENSMUST00000170239] [ENSMUST00000183214]
Predicted Effect probably benign
Transcript: ENSMUST00000045186
AA Change: V142I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000038326
Gene: ENSMUSG00000002500
AA Change: V142I

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 181 5.1e-72 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000101800
SMART Domains Protein: ENSMUSP00000099300
Gene: ENSMUSG00000075705

DomainStartEndE-ValueType
Pfam:SelR 5 105 9.7e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115262
SMART Domains Protein: ENSMUSP00000110917
Gene: ENSMUSG00000075705

DomainStartEndE-ValueType
Pfam:SelR 7 106 6.9e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170239
AA Change: V309I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000129325
Gene: ENSMUSG00000002500
AA Change: V309I

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 375 1.2e-178 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000183214
SMART Domains Protein: ENSMUSP00000138489
Gene: ENSMUSG00000002500

DomainStartEndE-ValueType
Pfam:Ribosomal_L3 1 133 1.1e-43 PFAM
Meta Mutation Damage Score 0.0898 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency 98% (49/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that shares sequence similarity with ribosomal protein L3. The protein belongs to the L3P family of ribosomal proteins. Unlike the ubiquitous expression of ribosomal protein genes, this gene has a tissue-specific pattern of expression, with the highest levels of expression in skeletal muscle and heart. It is not currently known whether the encoded protein is a functional ribosomal protein or whether it has evolved a function that is independent of the ribosome. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 50 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb5 A C 12: 118,874,644 V1061G probably damaging Het
Acap1 A G 11: 69,890,587 probably null Het
Apbb1 A G 7: 105,566,695 F112L probably benign Het
Atg9a A G 1: 75,185,058 S615P probably benign Het
Atp8a2 G A 14: 60,012,399 R548* probably null Het
Bbof1 A T 12: 84,411,168 N69I possibly damaging Het
Bcl2l14 T A 6: 134,427,407 V186D probably benign Het
Bmp1 T G 14: 70,491,383 Y583S possibly damaging Het
Boc A C 16: 44,492,348 S586R probably benign Het
Btbd9 A T 17: 30,299,736 probably null Het
Cacna1e T C 1: 154,442,173 M1180V probably damaging Het
Ciao1 T C 2: 127,246,456 H149R probably damaging Het
Cops5 T C 1: 10,030,695 probably benign Het
Doc2b T C 11: 75,795,625 Y90C probably benign Het
Doc2b C T 11: 75,780,267 R209Q probably damaging Het
Ep400 A G 5: 110,753,809 F481L probably benign Het
Fat4 T A 3: 39,007,080 probably null Het
Fbxw16 T A 9: 109,448,769 probably benign Het
Fbxw27 T C 9: 109,772,086 E17G possibly damaging Het
Gm29735 G A 7: 142,156,630 P162S unknown Het
Gypa T G 8: 80,496,340 S24R unknown Het
Hdhd5 T C 6: 120,518,524 N153D probably benign Het
Ibsp C A 5: 104,302,121 probably null Het
Klhdc3 C T 17: 46,678,046 V73I probably benign Het
Lrrc37a T C 11: 103,497,633 E2322G unknown Het
Lrrtm3 T C 10: 63,930,134 H558R probably benign Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mphosph9 A G 5: 124,320,915 V64A possibly damaging Het
Nthl1 C T 17: 24,638,501 R251C probably damaging Het
Numa1 G A 7: 102,000,767 R1235H probably benign Het
Olfr512 T C 7: 108,713,638 V95A probably damaging Het
Opn1sw T A 6: 29,379,414 Y197F possibly damaging Het
Pcca A T 14: 122,658,775 I268F probably benign Het
Per2 A T 1: 91,449,872 D76E unknown Het
Pfas T C 11: 68,997,999 N374S probably benign Het
Pomk C A 8: 25,982,927 V333F probably damaging Het
Ptgfr T C 3: 151,835,289 E194G probably benign Het
Ptpn14 C T 1: 189,850,800 P615S probably damaging Het
Pyroxd1 T C 6: 142,354,753 I203T probably benign Het
Rgs22 T C 15: 36,087,374 N466S probably benign Het
Rtkn2 C T 10: 67,979,699 probably benign Het
Sec16a C T 2: 26,428,241 A1613T probably damaging Het
Sis T A 3: 72,966,770 T33S probably damaging Het
Slc22a4 C A 11: 54,007,808 V153F possibly damaging Het
Stxbp1 C G 2: 32,794,609 E603Q probably damaging Het
Tiam2 A G 17: 3,509,556 S1291G probably damaging Het
Tmem94 T A 11: 115,796,746 L1144M probably damaging Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Vmn1r201 T C 13: 22,475,363 V249A probably benign Het
Wdr7 T A 18: 63,755,111 C552S probably damaging Het
Other mutations in Rpl3l
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00984:Rpl3l APN 17 24735471 missense probably damaging 0.96
IGL01364:Rpl3l APN 17 24732430 missense probably benign 0.07
IGL02009:Rpl3l APN 17 24732433 missense probably damaging 0.98
IGL02422:Rpl3l APN 17 24733988 nonsense probably null
IGL03309:Rpl3l APN 17 24736024 missense possibly damaging 0.64
PIT4468001:Rpl3l UTSW 17 24735483 missense probably benign 0.00
R1466:Rpl3l UTSW 17 24730871 missense probably benign
R1466:Rpl3l UTSW 17 24730871 missense probably benign
R1782:Rpl3l UTSW 17 24733456 missense probably benign 0.02
R2019:Rpl3l UTSW 17 24735516 unclassified probably benign
R2509:Rpl3l UTSW 17 24732386 missense possibly damaging 0.94
R3844:Rpl3l UTSW 17 24733942 missense probably benign 0.02
R4574:Rpl3l UTSW 17 24734010 missense possibly damaging 0.70
R4675:Rpl3l UTSW 17 24733610 missense probably benign 0.43
R5097:Rpl3l UTSW 17 24733461 missense probably damaging 1.00
R5106:Rpl3l UTSW 17 24732437 missense probably damaging 1.00
R5187:Rpl3l UTSW 17 24732455 missense possibly damaging 0.95
R6073:Rpl3l UTSW 17 24730887 missense probably benign
R7624:Rpl3l UTSW 17 24732427 missense probably benign
R7655:Rpl3l UTSW 17 24730986 missense probably benign 0.37
R7656:Rpl3l UTSW 17 24730986 missense probably benign 0.37
R7834:Rpl3l UTSW 17 24733463 missense possibly damaging 0.58
R7917:Rpl3l UTSW 17 24733463 missense possibly damaging 0.58
Z1177:Rpl3l UTSW 17 24728398 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TAGTTCCAGAGTCTGAGCATGTG -3'
(R):5'- GTGAGAACTGACGCTTTCAAG -3'

Sequencing Primer
(F):5'- TCTGAGCATGTGGGCCAAG -3'
(R):5'- CGCTTTCAAGTGTGCGAGAG -3'
Posted On2018-04-02