Mutagenetix > Incidental Mutation

Incidental Mutation 'R6296:Pikfyve'

508738

Institutional Source

Beutler Lab

Gene Symbol

Pikfyve

Ensembl Gene

ENSMUSG00000025949

Gene Name

phosphoinositide kinase, FYVE type zinc finger containing

Synonyms

PipkIII, Pip5k3, 5230400C17Rik

MMRRC Submission

044407-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6296 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

65225842-65317854 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 65302112 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Serine to Threonine at position 1668 (S1668T)

Ref Sequence

ENSEMBL: ENSMUSP00000095314 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081154] [ENSMUST00000097707]

AlphaFold

Q9Z1T6

Predicted Effect

possibly damaging
Transcript: ENSMUST00000081154
AA Change: S1623T

PolyPhen 2 Score 0.682 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000079926
Gene: ENSMUSG00000025949
AA Change: S1623T

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	161	230	5.95e-18	SMART
DEP	376	451	9.05e-27	SMART
Pfam:Cpn60_TCP1	547	822	2e-37	PFAM
low complexity region	1177	1189	N/A	INTRINSIC
low complexity region	1516	1536	N/A	INTRINSIC
PIPKc	1745	2039	3.03e-162	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000097707
AA Change: S1668T

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000095314
Gene: ENSMUSG00000025949
AA Change: S1668T

Domain	Start	End	E-Value	Type
low complexity region	58	81	N/A	INTRINSIC
FYVE	150	219	5.95e-18	SMART
DEP	365	440	9.05e-27	SMART
Pfam:Cpn60_TCP1	590	864	1.8e-35	PFAM
low complexity region	1222	1234	N/A	INTRINSIC
low complexity region	1561	1581	N/A	INTRINSIC
PIPKc	1790	2084	3.03e-162	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Phosphorylated derivatives of phosphatidylinositol (PtdIns) regulate cytoskeletal functions, membrane trafficking, and receptor signaling by recruiting protein complexes to cell- and endosomal-membranes. Humans have multiple PtdIns proteins that differ by the degree and position of phosphorylation of the inositol ring. This gene encodes an enzyme (PIKfyve; also known as phosphatidylinositol-3-phosphate 5-kinase type III or PIPKIII) that phosphorylates the D-5 position in PtdIns and phosphatidylinositol-3-phosphate (PtdIns3P) to make PtdIns5P and PtdIns(3,5)biphosphate. The D-5 position also can be phosphorylated by type I PtdIns4P-5-kinases (PIP5Ks) that are encoded by distinct genes and preferentially phosphorylate D-4 phosphorylated PtdIns. In contrast, PIKfyve preferentially phosphorylates D-3 phosphorylated PtdIns. In addition to being a lipid kinase, PIKfyve also has protein kinase activity. PIKfyve regulates endomembrane homeostasis and plays a role in the biogenesis of endosome carrier vesicles from early endosomes. Mutations in this gene cause corneal fleck dystrophy (CFD); an autosomal dominant disorder characterized by numerous small white flecks present in all layers of the corneal stroma. Histologically, these flecks appear to be keratocytes distended with lipid and mucopolysaccharide filled intracytoplasmic vacuoles. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null allele die prior to implantation with reduced numbers of inner cell mass and trophectoderm cells and blastocoele abnormalities. Mice homozygous for a second null allele show embryonic lethality between somite formation and embryo turning with abnormal visceral endoderm. [provided by MGI curators]

Allele List at MGI

All alleles(16) : Gene trapped(16)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4933427D14Rik	T	C	11: 72,086,580 (GRCm39)	K277R	probably damaging	Het
Aatf	T	C	11: 84,363,926 (GRCm39)	Y267C	probably benign	Het
Adcy5	A	G	16: 35,124,080 (GRCm39)	Y1253C	probably damaging	Het
Adgra3	G	A	5: 50,118,189 (GRCm39)	P1120S	probably benign	Het
Adm	A	G	7: 110,227,561 (GRCm39)	T26A	probably benign	Het
Ahnak	T	G	19: 8,980,669 (GRCm39)	V651G	probably damaging	Het
Akr7a5	G	A	4: 139,045,532 (GRCm39)	V358I	probably benign	Het
Ankar	T	G	1: 72,682,417 (GRCm39)	T1383P	probably damaging	Het
Bpifb6	G	C	2: 153,748,812 (GRCm39)	K269N	possibly damaging	Het
Cacna1c	T	C	6: 118,575,684 (GRCm39)	E1927G	possibly damaging	Het
Cacna1c	T	A	6: 118,629,675 (GRCm39)	T1249S	probably benign	Het
Cacna1h	G	A	17: 25,602,053 (GRCm39)	R1596C	probably damaging	Het
Cbll1	A	G	12: 31,537,507 (GRCm39)	V415A	probably benign	Het
Cd300lf	C	T	11: 115,015,195 (GRCm39)	V132I	probably benign	Het
Cfap54	T	C	10: 92,902,708 (GRCm39)	Y148C	probably damaging	Het
Coa5	A	G	1: 37,467,428 (GRCm39)	S60P	probably damaging	Het
Col6a2	T	C	10: 76,446,883 (GRCm39)	N342D	probably damaging	Het
Cyp2c29	T	G	19: 39,318,705 (GRCm39)	I434S	possibly damaging	Het
Ddx11	G	A	17: 66,457,724 (GRCm39)		probably null	Het
Dgke	C	T	11: 88,931,575 (GRCm39)	V560I	probably benign	Het
Dusp16	C	A	6: 134,697,456 (GRCm39)		probably null	Het
Enpp4	G	T	17: 44,413,371 (GRCm39)	N54K	probably benign	Het
Epn1	G	A	7: 5,093,122 (GRCm39)	A145T	probably damaging	Het
Erc2	A	T	14: 27,802,112 (GRCm39)	K764M	probably damaging	Het
Ercc6	G	T	14: 32,248,360 (GRCm39)	E304*	probably null	Het
Fam117a	T	A	11: 95,254,971 (GRCm39)	C115S	possibly damaging	Het
Galntl5	T	C	5: 25,391,163 (GRCm39)	S21P	probably benign	Het
Gm6358	T	C	16: 88,937,970 (GRCm39)	S70P	unknown	Het
Grip1	C	T	10: 119,911,369 (GRCm39)	Q696*	probably null	Het
Haus5	C	T	7: 30,358,401 (GRCm39)	W298*	probably null	Het
Hsfy2	T	A	1: 56,676,351 (GRCm39)	H62L	probably benign	Het
Ighm	T	C	12: 113,385,187 (GRCm39)	I258V	unknown	Het
Igkv13-71-1	G	T	6: 69,212,783 (GRCm39)		noncoding transcript	Het
Inava	C	T	1: 136,148,809 (GRCm39)		probably null	Het
Irx1	A	C	13: 72,107,787 (GRCm39)	S298R	probably damaging	Het
Jarid2	T	A	13: 45,056,539 (GRCm39)	Y443N	possibly damaging	Het
Kcnc1	G	A	7: 46,084,740 (GRCm39)	A555T	probably benign	Het
Krtap4-6	T	A	11: 99,556,245 (GRCm39)	R161*	probably null	Het
Lipo3	T	C	19: 33,757,737 (GRCm39)	D244G	probably benign	Het
Lmo2	T	G	2: 103,800,946 (GRCm39)	V39G	possibly damaging	Het
Lrch2	C	T	X: 146,263,553 (GRCm39)	A369T	probably damaging	Homo
Macf1	A	T	4: 123,326,668 (GRCm39)	I4943N	probably damaging	Het
Mkx	A	T	18: 7,000,591 (GRCm39)		probably null	Het
Nek1	C	T	8: 61,525,343 (GRCm39)	Q594*	probably null	Het
Nipbl	T	C	15: 8,330,379 (GRCm39)	M2349V	possibly damaging	Het
Nup155	T	A	15: 8,182,639 (GRCm39)	C1201S	probably damaging	Het
Or2y8	C	A	11: 52,035,423 (GRCm39)	R311S	probably benign	Het
Or4a76	G	A	2: 89,460,975 (GRCm39)	T89I	probably damaging	Het
Or5ac25	T	C	16: 59,181,769 (GRCm39)	K271E	probably benign	Het
Osbpl1a	A	G	18: 12,952,560 (GRCm39)		probably null	Het
Pbx1	T	C	1: 168,011,184 (GRCm39)	D372G	possibly damaging	Het
Pitpnc1	T	C	11: 107,117,092 (GRCm39)	H193R	probably damaging	Het
Plag1	G	T	4: 3,904,499 (GRCm39)	H231N	probably damaging	Het
Prmt8	A	G	6: 127,688,767 (GRCm39)	I201T	probably damaging	Het
Ptpn23	A	T	9: 110,222,894 (GRCm39)	N54K	probably damaging	Het
Rab11fip4	T	C	11: 79,581,655 (GRCm39)		probably null	Het
Rassf9	T	A	10: 102,381,614 (GRCm39)	I332N	probably damaging	Het
Rgs9	T	C	11: 109,159,813 (GRCm39)	N173S	probably benign	Het
Rhbdl1	A	G	17: 26,053,943 (GRCm39)	L309P	probably damaging	Het
Rnf214	A	G	9: 45,779,119 (GRCm39)	S389P	probably benign	Het
Rxfp1	A	C	3: 79,575,155 (GRCm39)	L181R	probably damaging	Het
Sfxn1	C	T	13: 54,247,899 (GRCm39)	T208I	probably benign	Het
Sgo2b	C	T	8: 64,380,827 (GRCm39)	M668I	probably benign	Het
Sh3bp4	C	A	1: 89,073,211 (GRCm39)	S686R	probably damaging	Het
Spata31d1d	G	A	13: 59,876,278 (GRCm39)	T419I	possibly damaging	Het
Spata31d1e	T	C	13: 59,890,497 (GRCm39)	D441G	probably benign	Het
Spink5	T	C	18: 44,147,824 (GRCm39)	S857P	probably damaging	Het
Stard13	A	T	5: 150,986,138 (GRCm39)	S339R	probably damaging	Het
Stk35	T	A	2: 129,652,808 (GRCm39)	Y436*	probably null	Het
Supt6	C	T	11: 78,116,885 (GRCm39)	R589Q	possibly damaging	Het
Tinag	T	A	9: 76,904,217 (GRCm39)	E402V	possibly damaging	Het
Tmem183a	T	C	1: 134,289,349 (GRCm39)	D27G	probably damaging	Het
Tnfrsf13c	T	C	15: 82,108,103 (GRCm39)	T56A	probably damaging	Het
Tnrc18	A	C	5: 142,719,331 (GRCm39)	L1985R	unknown	Het
Ttn	G	A	2: 76,579,673 (GRCm39)	T23740M	probably damaging	Het
Ufl1	G	T	4: 25,270,572 (GRCm39)	Q215K	probably benign	Het
Unkl	T	C	17: 25,450,839 (GRCm39)	*232R	probably null	Het
Wnk4	A	T	11: 101,164,824 (GRCm39)	N718Y	probably damaging	Het
Xkr4	T	C	1: 3,286,793 (GRCm39)	T466A	probably benign	Het
Zfp451	T	A	1: 33,808,898 (GRCm39)	K988*	probably null	Het
Zfp503	G	C	14: 22,035,868 (GRCm39)	Y349*	probably null	Het
Zfp990	T	A	4: 145,264,673 (GRCm39)	F557Y	possibly damaging	Het

Other mutations in Pikfyve

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00162:Pikfyve	APN	1	65,299,280 (GRCm39)	critical splice donor site	probably null
IGL01135:Pikfyve	APN	1	65,290,794 (GRCm39)	missense	probably damaging	0.96
IGL01511:Pikfyve	APN	1	65,298,028 (GRCm39)	nonsense	probably null
IGL01759:Pikfyve	APN	1	65,292,512 (GRCm39)	missense	probably benign	0.06
IGL01888:Pikfyve	APN	1	65,262,799 (GRCm39)	missense	probably damaging	1.00
IGL01967:Pikfyve	APN	1	65,303,524 (GRCm39)	missense	possibly damaging	0.89
IGL02055:Pikfyve	APN	1	65,277,703 (GRCm39)	critical splice donor site	probably null
IGL02119:Pikfyve	APN	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
IGL02141:Pikfyve	APN	1	65,285,556 (GRCm39)	missense	probably benign	0.13
IGL02207:Pikfyve	APN	1	65,290,837 (GRCm39)	critical splice donor site	probably null
IGL02380:Pikfyve	APN	1	65,295,180 (GRCm39)	missense	probably damaging	0.99
IGL02400:Pikfyve	APN	1	65,291,728 (GRCm39)	missense	probably damaging	1.00
IGL02403:Pikfyve	APN	1	65,283,663 (GRCm39)	missense	probably damaging	0.99
IGL02426:Pikfyve	APN	1	65,290,771 (GRCm39)	missense	possibly damaging	0.77
IGL02496:Pikfyve	APN	1	65,303,535 (GRCm39)	missense	possibly damaging	0.94
IGL02573:Pikfyve	APN	1	65,270,014 (GRCm39)	critical splice donor site	probably null
IGL02746:Pikfyve	APN	1	65,273,431 (GRCm39)	missense	probably damaging	1.00
IGL02814:Pikfyve	APN	1	65,289,353 (GRCm39)	nonsense	probably null
IGL02890:Pikfyve	APN	1	65,269,956 (GRCm39)	missense	probably benign	0.00
IGL03102:Pikfyve	APN	1	65,291,626 (GRCm39)	nonsense	probably null
IGL03294:Pikfyve	APN	1	65,286,226 (GRCm39)	missense	probably damaging	1.00
falcon	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
oompa	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
wonka	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
G5538:Pikfyve	UTSW	1	65,242,075 (GRCm39)	missense	probably damaging	1.00
R0031:Pikfyve	UTSW	1	65,255,088 (GRCm39)	splice site	probably benign
R0196:Pikfyve	UTSW	1	65,295,231 (GRCm39)	missense	possibly damaging	0.92
R0212:Pikfyve	UTSW	1	65,302,064 (GRCm39)	missense	probably benign	0.41
R0319:Pikfyve	UTSW	1	65,285,490 (GRCm39)	missense	probably benign	0.01
R0332:Pikfyve	UTSW	1	65,303,558 (GRCm39)	missense	probably benign	0.02
R0389:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0443:Pikfyve	UTSW	1	65,235,865 (GRCm39)	missense	probably damaging	1.00
R0503:Pikfyve	UTSW	1	65,259,058 (GRCm39)	missense	probably damaging	0.97
R0722:Pikfyve	UTSW	1	65,292,682 (GRCm39)	missense	probably damaging	0.99
R0906:Pikfyve	UTSW	1	65,292,556 (GRCm39)	missense	probably damaging	1.00
R0907:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R0970:Pikfyve	UTSW	1	65,304,983 (GRCm39)	missense	probably damaging	0.99
R1188:Pikfyve	UTSW	1	65,286,118 (GRCm39)	missense	possibly damaging	0.46
R1412:Pikfyve	UTSW	1	65,241,989 (GRCm39)	missense	possibly damaging	0.64
R1421:Pikfyve	UTSW	1	65,310,470 (GRCm39)	missense	probably damaging	1.00
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1468:Pikfyve	UTSW	1	65,290,825 (GRCm39)	missense	probably damaging	0.98
R1472:Pikfyve	UTSW	1	65,263,360 (GRCm39)	missense	probably damaging	0.96
R1478:Pikfyve	UTSW	1	65,302,136 (GRCm39)	critical splice donor site	probably null
R1501:Pikfyve	UTSW	1	65,304,443 (GRCm39)	missense	possibly damaging	0.84
R1757:Pikfyve	UTSW	1	65,291,707 (GRCm39)	missense	probably damaging	0.99
R1773:Pikfyve	UTSW	1	65,285,529 (GRCm39)	missense	probably benign
R1773:Pikfyve	UTSW	1	65,231,430 (GRCm39)	missense	probably damaging	0.99
R1795:Pikfyve	UTSW	1	65,291,716 (GRCm39)	missense	probably damaging	1.00
R1855:Pikfyve	UTSW	1	65,297,957 (GRCm39)	missense	probably benign	0.03
R1905:Pikfyve	UTSW	1	65,231,454 (GRCm39)	critical splice donor site	probably null
R1995:Pikfyve	UTSW	1	65,285,867 (GRCm39)	missense	probably damaging	1.00
R2034:Pikfyve	UTSW	1	65,261,516 (GRCm39)	missense	probably damaging	1.00
R2045:Pikfyve	UTSW	1	65,292,512 (GRCm39)	missense	probably benign	0.06
R2229:Pikfyve	UTSW	1	65,307,014 (GRCm39)	missense	probably damaging	1.00
R2295:Pikfyve	UTSW	1	65,285,835 (GRCm39)	missense	probably damaging	0.99
R2913:Pikfyve	UTSW	1	65,292,676 (GRCm39)	missense	probably damaging	1.00
R3818:Pikfyve	UTSW	1	65,284,917 (GRCm39)	missense	probably damaging	1.00
R3832:Pikfyve	UTSW	1	65,283,579 (GRCm39)	missense	probably damaging	0.99
R3850:Pikfyve	UTSW	1	65,270,004 (GRCm39)	missense	probably damaging	1.00
R3946:Pikfyve	UTSW	1	65,235,840 (GRCm39)	missense	probably damaging	1.00
R4105:Pikfyve	UTSW	1	65,229,679 (GRCm39)	unclassified	probably benign
R4542:Pikfyve	UTSW	1	65,283,589 (GRCm39)	missense	probably damaging	1.00
R4574:Pikfyve	UTSW	1	65,231,351 (GRCm39)	missense	probably damaging	1.00
R4601:Pikfyve	UTSW	1	65,273,421 (GRCm39)	missense	probably damaging	1.00
R4667:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4668:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4669:Pikfyve	UTSW	1	65,289,432 (GRCm39)	missense	probably damaging	1.00
R4707:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4716:Pikfyve	UTSW	1	65,285,635 (GRCm39)	missense	possibly damaging	0.84
R4758:Pikfyve	UTSW	1	65,311,674 (GRCm39)	missense	possibly damaging	0.84
R4784:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4785:Pikfyve	UTSW	1	65,307,005 (GRCm39)	missense	probably benign
R4805:Pikfyve	UTSW	1	65,307,959 (GRCm39)	missense	probably damaging	0.99
R4831:Pikfyve	UTSW	1	65,235,900 (GRCm39)	missense	probably damaging	1.00
R4837:Pikfyve	UTSW	1	65,285,749 (GRCm39)	missense	possibly damaging	0.92
R5064:Pikfyve	UTSW	1	65,292,566 (GRCm39)	missense	probably damaging	1.00
R5115:Pikfyve	UTSW	1	65,263,276 (GRCm39)	intron	probably benign
R5265:Pikfyve	UTSW	1	65,306,988 (GRCm39)	missense	possibly damaging	0.72
R5279:Pikfyve	UTSW	1	65,235,858 (GRCm39)	nonsense	probably null
R5384:Pikfyve	UTSW	1	65,283,568 (GRCm39)	missense	probably damaging	1.00
R5387:Pikfyve	UTSW	1	65,304,427 (GRCm39)	missense	possibly damaging	0.94
R5461:Pikfyve	UTSW	1	65,274,192 (GRCm39)	missense	probably damaging	1.00
R5467:Pikfyve	UTSW	1	65,291,654 (GRCm39)	missense	probably damaging	1.00
R5560:Pikfyve	UTSW	1	65,292,566 (GRCm39)	missense	probably damaging	1.00
R5575:Pikfyve	UTSW	1	65,312,889 (GRCm39)	missense	probably damaging	1.00
R5611:Pikfyve	UTSW	1	65,295,247 (GRCm39)	missense	probably damaging	0.96
R5663:Pikfyve	UTSW	1	65,255,187 (GRCm39)	missense	probably benign	0.09
R5891:Pikfyve	UTSW	1	65,241,896 (GRCm39)	missense	probably damaging	1.00
R5960:Pikfyve	UTSW	1	65,292,597 (GRCm39)	nonsense	probably null
R6026:Pikfyve	UTSW	1	65,311,856 (GRCm39)	missense	probably damaging	1.00
R6057:Pikfyve	UTSW	1	65,311,730 (GRCm39)	missense	probably damaging	1.00
R6101:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6105:Pikfyve	UTSW	1	65,303,504 (GRCm39)	critical splice acceptor site	probably null
R6161:Pikfyve	UTSW	1	65,255,202 (GRCm39)	missense	probably benign	0.36
R6287:Pikfyve	UTSW	1	65,292,691 (GRCm39)	critical splice donor site	probably null
R6290:Pikfyve	UTSW	1	65,242,084 (GRCm39)	critical splice donor site	probably null
R6516:Pikfyve	UTSW	1	65,304,940 (GRCm39)	missense	probably benign	0.35
R6835:Pikfyve	UTSW	1	65,298,002 (GRCm39)	missense	probably damaging	0.98
R6994:Pikfyve	UTSW	1	65,291,689 (GRCm39)	missense	probably damaging	1.00
R6997:Pikfyve	UTSW	1	65,285,822 (GRCm39)	missense	probably damaging	1.00
R7038:Pikfyve	UTSW	1	65,273,520 (GRCm39)	missense	probably damaging	1.00
R7044:Pikfyve	UTSW	1	65,286,013 (GRCm39)	missense	probably benign	0.01
R7057:Pikfyve	UTSW	1	65,286,364 (GRCm39)	missense	probably benign	0.00
R7525:Pikfyve	UTSW	1	65,283,585 (GRCm39)	nonsense	probably null
R7558:Pikfyve	UTSW	1	65,311,782 (GRCm39)	missense	probably benign	0.01
R7625:Pikfyve	UTSW	1	65,307,036 (GRCm39)	missense	possibly damaging	0.86
R7807:Pikfyve	UTSW	1	65,309,101 (GRCm39)	missense	probably damaging	1.00
R7961:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8009:Pikfyve	UTSW	1	65,294,293 (GRCm39)	missense	probably damaging	1.00
R8154:Pikfyve	UTSW	1	65,304,948 (GRCm39)	missense	probably damaging	1.00
R8192:Pikfyve	UTSW	1	65,285,554 (GRCm39)	missense	possibly damaging	0.93
R8275:Pikfyve	UTSW	1	65,292,501 (GRCm39)	splice site	probably benign
R8307:Pikfyve	UTSW	1	65,284,894 (GRCm39)	missense	possibly damaging	0.77
R8710:Pikfyve	UTSW	1	65,255,155 (GRCm39)	missense	possibly damaging	0.94
R8867:Pikfyve	UTSW	1	65,283,576 (GRCm39)	missense	probably damaging	1.00
R8936:Pikfyve	UTSW	1	65,310,427 (GRCm39)	missense	possibly damaging	0.84
R8940:Pikfyve	UTSW	1	65,286,129 (GRCm39)	missense	probably benign	0.00
R8995:Pikfyve	UTSW	1	65,244,746 (GRCm39)	critical splice acceptor site	probably null
R9092:Pikfyve	UTSW	1	65,283,559 (GRCm39)	missense	probably damaging	1.00
R9131:Pikfyve	UTSW	1	65,285,239 (GRCm39)	missense	probably damaging	1.00
R9151:Pikfyve	UTSW	1	65,235,898 (GRCm39)	missense	probably damaging	1.00
R9210:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9212:Pikfyve	UTSW	1	65,291,719 (GRCm39)	missense	probably damaging	1.00
R9235:Pikfyve	UTSW	1	65,299,188 (GRCm39)	missense	probably benign	0.37
R9368:Pikfyve	UTSW	1	65,307,901 (GRCm39)	missense	probably damaging	1.00
R9489:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9605:Pikfyve	UTSW	1	65,303,561 (GRCm39)	missense	probably benign
R9686:Pikfyve	UTSW	1	65,291,615 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TTTGGCCAAGGTCTTGACAG -3'
(R):5'- AGCCATGCATCATCCCATTG -3'

Sequencing Primer
(F):5'- AAGAGAGCATTGGATTCCTCCTG -3'
(R):5'- GCCATGCATCATCCCATTGTTAAAG -3'

Posted On

2018-04-02