Incidental Mutation 'R6296:Ankar'
ID508739
Institutional Source Beutler Lab
Gene Symbol Ankar
Ensembl Gene ENSMUSG00000039342
Gene Nameankyrin and armadillo repeat containing
Synonyms4932422E22Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6296 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location72642980-72700579 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 72643258 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 1383 (T1383P)
Ref Sequence ENSEMBL: ENSMUSP00000054056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053499] [ENSMUST00000211837] [ENSMUST00000212573]
Predicted Effect probably damaging
Transcript: ENSMUST00000053499
AA Change: T1383P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054056
Gene: ENSMUSG00000039342
AA Change: T1383P

DomainStartEndE-ValueType
low complexity region 46 51 N/A INTRINSIC
low complexity region 484 496 N/A INTRINSIC
ANK 532 561 1.25e2 SMART
ANK 582 611 3.49e0 SMART
ANK 615 644 4.44e2 SMART
ANK 651 680 3.8e-1 SMART
ANK 684 714 9.87e0 SMART
ARM 744 784 5.96e-3 SMART
ARM 785 825 4.09e0 SMART
Blast:ARM 827 865 1e-15 BLAST
ARM 867 907 8.34e0 SMART
ARM 909 949 8.34e0 SMART
Blast:ARM 951 991 2e-13 BLAST
ARM 1034 1077 4.82e1 SMART
ARM 1084 1123 1.3e1 SMART
ARM 1257 1297 6.01e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000211837
AA Change: T1382P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000211909
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212057
Predicted Effect probably damaging
Transcript: ENSMUST00000212573
AA Change: T1165P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
5730559C18Rik C T 1: 136,221,071 probably null Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Adcy5 A G 16: 35,303,710 Y1253C probably damaging Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Adm A G 7: 110,628,354 T26A probably benign Het
Ahnak T G 19: 9,003,305 V651G probably damaging Het
Akr7a5 G A 4: 139,318,221 V358I probably benign Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cacna1h G A 17: 25,383,079 R1596C probably damaging Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Cfap54 T C 10: 93,066,846 Y148C probably damaging Het
Coa5 A G 1: 37,428,347 S60P probably damaging Het
Col6a2 T C 10: 76,611,049 N342D probably damaging Het
Cyp2c29 T G 19: 39,330,261 I434S possibly damaging Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dusp16 C A 6: 134,720,493 probably null Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Epn1 G A 7: 5,090,123 A145T probably damaging Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Gm6358 T C 16: 89,141,082 S70P unknown Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hsfy2 T A 1: 56,637,192 H62L probably benign Het
Ighm T C 12: 113,421,567 I258V unknown Het
Igkv13-71-1 G T 6: 69,235,799 noncoding transcript Het
Irx1 A C 13: 71,959,668 S298R probably damaging Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kcnc1 G A 7: 46,435,316 A555T probably benign Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lipo1 T C 19: 33,780,337 D244G probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Macf1 A T 4: 123,432,875 I4943N probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr209 T C 16: 59,361,406 K271E probably benign Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pbx1 T C 1: 168,183,615 D372G possibly damaging Het
Pikfyve T A 1: 65,262,953 S1668T probably damaging Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Plag1 G T 4: 3,904,499 H231N probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Ptpn23 A T 9: 110,393,826 N54K probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rassf9 T A 10: 102,545,753 I332N probably damaging Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rnf214 A G 9: 45,867,821 S389P probably benign Het
Rxfp1 A C 3: 79,667,848 L181R probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Sh3bp4 C A 1: 89,145,489 S686R probably damaging Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stard13 A T 5: 151,062,673 S339R probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tinag T A 9: 76,996,935 E402V possibly damaging Het
Tmem183a T C 1: 134,361,611 D27G probably damaging Het
Tnfrsf13c T C 15: 82,223,902 T56A probably damaging Het
Tnrc18 A C 5: 142,733,576 L1985R unknown Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Ufl1 G T 4: 25,270,572 Q215K probably benign Het
Unkl T C 17: 25,231,865 *232R probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Xkr4 T C 1: 3,216,570 T466A probably benign Het
Zfp451 T A 1: 33,769,817 K988* probably null Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Ankar
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00338:Ankar APN 1 72690131 missense probably damaging 1.00
IGL01013:Ankar APN 1 72650989 missense possibly damaging 0.90
IGL01135:Ankar APN 1 72665219 missense probably benign 0.28
IGL01824:Ankar APN 1 72651727 missense probably benign 0.40
IGL01885:Ankar APN 1 72658703 missense probably damaging 1.00
IGL01932:Ankar APN 1 72698987 missense probably benign 0.25
IGL02143:Ankar APN 1 72658649 critical splice donor site probably null
IGL02326:Ankar APN 1 72666355 missense probably damaging 1.00
IGL02445:Ankar APN 1 72666365 missense probably benign 0.05
IGL02606:Ankar APN 1 72690285 missense possibly damaging 0.61
IGL02635:Ankar APN 1 72652431 missense possibly damaging 0.93
IGL02680:Ankar APN 1 72670116 missense probably damaging 1.00
IGL02704:Ankar APN 1 72652343 missense possibly damaging 0.88
IGL03086:Ankar APN 1 72643278 missense possibly damaging 0.84
IGL03269:Ankar APN 1 72665201 missense probably damaging 0.99
IGL03368:Ankar APN 1 72675813 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0050:Ankar UTSW 1 72656164 missense probably damaging 1.00
R0488:Ankar UTSW 1 72658732 missense probably damaging 1.00
R0650:Ankar UTSW 1 72656221 splice site probably benign
R1121:Ankar UTSW 1 72651663 splice site probably null
R1163:Ankar UTSW 1 72688705 missense possibly damaging 0.82
R1300:Ankar UTSW 1 72643164 missense probably benign 0.00
R1309:Ankar UTSW 1 72674004 missense possibly damaging 0.59
R1366:Ankar UTSW 1 72698649 missense probably damaging 1.00
R1456:Ankar UTSW 1 72665118 missense probably benign 0.34
R1495:Ankar UTSW 1 72643291 missense probably benign
R1583:Ankar UTSW 1 72679555 splice site probably benign
R1635:Ankar UTSW 1 72650138 missense probably damaging 0.99
R1975:Ankar UTSW 1 72658441 missense possibly damaging 0.95
R2036:Ankar UTSW 1 72666530 nonsense probably null
R2511:Ankar UTSW 1 72658694 missense probably damaging 1.00
R2965:Ankar UTSW 1 72675820 missense probably benign 0.00
R3404:Ankar UTSW 1 72643093 nonsense probably null
R3417:Ankar UTSW 1 72658976 critical splice donor site probably null
R4072:Ankar UTSW 1 72688592 missense probably damaging 1.00
R4231:Ankar UTSW 1 72658542 missense probably benign 0.23
R4447:Ankar UTSW 1 72687789 missense possibly damaging 0.60
R4632:Ankar UTSW 1 72647184 missense probably benign 0.01
R4720:Ankar UTSW 1 72699011 missense possibly damaging 0.55
R4754:Ankar UTSW 1 72698694 missense probably damaging 1.00
R4884:Ankar UTSW 1 72698807 missense probably damaging 0.97
R5068:Ankar UTSW 1 72680210 splice site probably null
R5069:Ankar UTSW 1 72680210 splice site probably null
R5070:Ankar UTSW 1 72680210 splice site probably null
R5189:Ankar UTSW 1 72658414 missense probably benign 0.01
R5247:Ankar UTSW 1 72680184 missense probably benign 0.08
R5322:Ankar UTSW 1 72690386 splice site probably null
R5345:Ankar UTSW 1 72670151 missense possibly damaging 0.94
R5864:Ankar UTSW 1 72659165 missense probably benign 0.00
R5976:Ankar UTSW 1 72643291 missense probably benign
R6003:Ankar UTSW 1 72698887 missense probably damaging 1.00
R6042:Ankar UTSW 1 72674054 nonsense probably null
R6488:Ankar UTSW 1 72681808 critical splice donor site probably null
R6885:Ankar UTSW 1 72643036 missense unknown
R6985:Ankar UTSW 1 72658482 missense probably damaging 1.00
R7060:Ankar UTSW 1 72656113 missense probably benign 0.18
R7099:Ankar UTSW 1 72643293 missense probably damaging 0.99
R7194:Ankar UTSW 1 72659033 missense probably benign 0.32
R7221:Ankar UTSW 1 72650231 missense probably damaging 1.00
R7222:Ankar UTSW 1 72666355 missense probably damaging 0.99
R7258:Ankar UTSW 1 72651727 missense probably benign 0.40
R7303:Ankar UTSW 1 72659033 missense probably benign 0.32
R7308:Ankar UTSW 1 72651794 nonsense probably null
R7384:Ankar UTSW 1 72658465 missense probably benign 0.00
R7424:Ankar UTSW 1 72680058 missense probably damaging 1.00
R7464:Ankar UTSW 1 72698894 missense possibly damaging 0.94
R7525:Ankar UTSW 1 72688641 missense probably benign 0.18
R7618:Ankar UTSW 1 72675766 missense probably benign 0.22
R7659:Ankar UTSW 1 72690135 missense possibly damaging 0.95
R7974:Ankar UTSW 1 72698979 nonsense probably null
R8008:Ankar UTSW 1 72666484 missense possibly damaging 0.47
R8119:Ankar UTSW 1 72647001 missense probably damaging 0.98
R8244:Ankar UTSW 1 72651024 missense probably benign
R8342:Ankar UTSW 1 72652460 missense probably damaging 1.00
Z1176:Ankar UTSW 1 72689961 missense possibly damaging 0.95
Predicted Primers PCR Primer
(F):5'- AAATGCTGGAGGGTCTGGGT -3'
(R):5'- GGCCAATGACAGTGTATGTTGTC -3'

Sequencing Primer
(F):5'- GGGTTGGCTTTCTGTTCATCTTTCC -3'
(R):5'- CTGATCCTTTTTAGAAGACCCGAG -3'
Posted On2018-04-02