Mutagenetix > Incidental Mutations

Incidental Mutation 'R6296:Stard13'

508758

Institutional Source

Beutler Lab

Gene Symbol

Stard13

Ensembl Gene

ENSMUSG00000016128

Gene Name

StAR-related lipid transfer (START) domain containing 13

Synonyms

GT650, DLC2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6296 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

151037510-151233836 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 151062673 bp

Zygosity

Heterozygous

Amino Acid Change

Serine to Arginine at position 339 (S339R)

Ref Sequence

ENSEMBL: ENSMUSP00000144056 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000062015] [ENSMUST00000110483] [ENSMUST00000129088] [ENSMUST00000202111] [ENSMUST00000202365]

Predicted Effect

probably damaging
Transcript: ENSMUST00000062015
AA Change: S457R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000053232
Gene: ENSMUSG00000016128
AA Change: S457R

Domain	Start	End	E-Value	Type
Pfam:SAM_2	59	120	2.6e-6	PFAM
low complexity region	197	216	N/A	INTRINSIC
low complexity region	322	340	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	612	624	N/A	INTRINSIC
RhoGAP	693	884	2.37e-50	SMART
START	927	1129	2.08e-40	SMART

Predicted Effect

probably damaging
Transcript: ENSMUST00000110483
AA Change: S457R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000106109
Gene: ENSMUSG00000016128
AA Change: S457R

Domain	Start	End	E-Value	Type
PDB:2JW2\|A	50	120	1e-37	PDB
low complexity region	197	216	N/A	INTRINSIC
low complexity region	322	340	N/A	INTRINSIC
low complexity region	473	486	N/A	INTRINSIC
low complexity region	612	624	N/A	INTRINSIC
RhoGAP	674	865	2.37e-50	SMART
START	908	1110	2.08e-40	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000129088

SMART Domains

Protein: ENSMUSP00000116705
Gene: ENSMUSG00000016128

Domain	Start	End	E-Value	Type
Blast:SAM	40	104	6e-32	BLAST
PDB:2JW2\|A	42	104	8e-33	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000141117

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000201680

Predicted Effect

probably damaging
Transcript: ENSMUST00000202111
AA Change: S339R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000144056
Gene: ENSMUSG00000016128
AA Change: S339R

Domain	Start	End	E-Value	Type
low complexity region	79	98	N/A	INTRINSIC
low complexity region	204	222	N/A	INTRINSIC
low complexity region	355	368	N/A	INTRINSIC
low complexity region	494	506	N/A	INTRINSIC
RhoGAP	556	747	1.4e-52	SMART
START	790	992	1.4e-42	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000202365

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000202385

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein which contains an N-terminal sterile alpha motif (SAM) for protein-protein interactions, followed by an ATP/GTP-binding motif, a GTPase-activating protein (GAP) domain, and a C-terminal STAR-related lipid transfer (START) domain. It may be involved in regulation of cytoskeletal reorganization, cell proliferation, and cell motility, and acts as a tumor suppressor in hepatoma cells. The gene is located in a region of chromosome 13 that is associated with loss of heterozygosity in hepatocellular carcinomas. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit small body size, decreased weight, and reduced adipose tissue. Mice homozygous for another knock-out allele exhibit increased angiogenesis in matrigel plugs and implanted tumors. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,683	D441G	probably benign	Het
4933427D14Rik	T	C	11: 72,195,754	K277R	probably damaging	Het
5730559C18Rik	C	T	1: 136,221,071		probably null	Het
Aatf	T	C	11: 84,473,100	Y267C	probably benign	Het
Adcy5	A	G	16: 35,303,710	Y1253C	probably damaging	Het
Adgra3	G	A	5: 49,960,847	P1120S	probably benign	Het
Adm	A	G	7: 110,628,354	T26A	probably benign	Het
Ahnak	T	G	19: 9,003,305	V651G	probably damaging	Het
Akr7a5	G	A	4: 139,318,221	V358I	probably benign	Het
Ankar	T	G	1: 72,643,258	T1383P	probably damaging	Het
Bpifb6	G	C	2: 153,906,892	K269N	possibly damaging	Het
Cacna1c	T	C	6: 118,598,723	E1927G	possibly damaging	Het
Cacna1c	T	A	6: 118,652,714	T1249S	probably benign	Het
Cacna1h	G	A	17: 25,383,079	R1596C	probably damaging	Het
Cbll1	A	G	12: 31,487,508	V415A	probably benign	Het
Cd300lf	C	T	11: 115,124,369	V132I	probably benign	Het
Cfap54	T	C	10: 93,066,846	Y148C	probably damaging	Het
Coa5	A	G	1: 37,428,347	S60P	probably damaging	Het
Col6a2	T	C	10: 76,611,049	N342D	probably damaging	Het
Cyp2c29	T	G	19: 39,330,261	I434S	possibly damaging	Het
Ddx11	G	A	17: 66,150,729		probably null	Het
Dgke	C	T	11: 89,040,749	V560I	probably benign	Het
Dusp16	C	A	6: 134,720,493		probably null	Het
Enpp4	G	T	17: 44,102,480	N54K	probably benign	Het
Epn1	G	A	7: 5,090,123	A145T	probably damaging	Het
Erc2	A	T	14: 28,080,155	K764M	probably damaging	Het
Ercc6	G	T	14: 32,526,403	E304*	probably null	Het
Fam117a	T	A	11: 95,364,145	C115S	possibly damaging	Het
Galntl5	T	C	5: 25,186,165	S21P	probably benign	Het
Gm6358	T	C	16: 89,141,082	S70P	unknown	Het
Grip1	C	T	10: 120,075,464	Q696*	probably null	Het
Haus5	C	T	7: 30,658,976	W298*	probably null	Het
Hsfy2	T	A	1: 56,637,192	H62L	probably benign	Het
Ighm	T	C	12: 113,421,567	I258V	unknown	Het
Igkv13-71-1	G	T	6: 69,235,799		noncoding transcript	Het
Irx1	A	C	13: 71,959,668	S298R	probably damaging	Het
Jarid2	T	A	13: 44,903,063	Y443N	possibly damaging	Het
Kcnc1	G	A	7: 46,435,316	A555T	probably benign	Het
Krtap4-6	T	A	11: 99,665,419	R161*	probably null	Het
Lipo1	T	C	19: 33,780,337	D244G	probably benign	Het
Lmo2	T	G	2: 103,970,601	V39G	possibly damaging	Het
Lrch2	C	T	X: 147,480,557	A369T	probably damaging	Homo
Macf1	A	T	4: 123,432,875	I4943N	probably damaging	Het
Mkx	A	T	18: 7,000,591		probably null	Het
Nek1	C	T	8: 61,072,309	Q594*	probably null	Het
Nipbl	T	C	15: 8,300,895	M2349V	possibly damaging	Het
Nup155	T	A	15: 8,153,155	C1201S	probably damaging	Het
Olfr1249	G	A	2: 89,630,631	T89I	probably damaging	Het
Olfr1373	C	A	11: 52,144,596	R311S	probably benign	Het
Olfr209	T	C	16: 59,361,406	K271E	probably benign	Het
Osbpl1a	A	G	18: 12,819,503		probably null	Het
Pbx1	T	C	1: 168,183,615	D372G	possibly damaging	Het
Pikfyve	T	A	1: 65,262,953	S1668T	probably damaging	Het
Pitpnc1	T	C	11: 107,226,266	H193R	probably damaging	Het
Plag1	G	T	4: 3,904,499	H231N	probably damaging	Het
Prmt8	A	G	6: 127,711,804	I201T	probably damaging	Het
Ptpn23	A	T	9: 110,393,826	N54K	probably damaging	Het
Rab11fip4	T	C	11: 79,690,829		probably null	Het
Rassf9	T	A	10: 102,545,753	I332N	probably damaging	Het
Rgs9	T	C	11: 109,268,987	N173S	probably benign	Het
Rhbdl1	A	G	17: 25,834,969	L309P	probably damaging	Het
Rnf214	A	G	9: 45,867,821	S389P	probably benign	Het
Rxfp1	A	C	3: 79,667,848	L181R	probably damaging	Het
Sfxn1	C	T	13: 54,093,880	T208I	probably benign	Het
Sgo2b	C	T	8: 63,927,793	M668I	probably benign	Het
Sh3bp4	C	A	1: 89,145,489	S686R	probably damaging	Het
Spata31d1d	G	A	13: 59,728,464	T419I	possibly damaging	Het
Spink5	T	C	18: 44,014,757	S857P	probably damaging	Het
Stk35	T	A	2: 129,810,888	Y436*	probably null	Het
Supt6	C	T	11: 78,226,059	R589Q	possibly damaging	Het
Tinag	T	A	9: 76,996,935	E402V	possibly damaging	Het
Tmem183a	T	C	1: 134,361,611	D27G	probably damaging	Het
Tnfrsf13c	T	C	15: 82,223,902	T56A	probably damaging	Het
Tnrc18	A	C	5: 142,733,576	L1985R	unknown	Het
Ttn	G	A	2: 76,749,329	T23740M	probably damaging	Het
Ufl1	G	T	4: 25,270,572	Q215K	probably benign	Het
Unkl	T	C	17: 25,231,865	*232R	probably null	Het
Wnk4	A	T	11: 101,273,998	N718Y	probably damaging	Het
Xkr4	T	C	1: 3,216,570	T466A	probably benign	Het
Zfp451	T	A	1: 33,769,817	K988*	probably null	Het
Zfp503	G	C	14: 21,985,800	Y349*	probably null	Het
Zfp990	T	A	4: 145,538,103	F557Y	possibly damaging	Het

Other mutations in Stard13

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00639:Stard13	APN	5	151042239	missense	probably damaging	1.00
IGL01362:Stard13	APN	5	151189952	missense	probably benign	0.05
IGL01588:Stard13	APN	5	151045237	missense	probably damaging	1.00
IGL01947:Stard13	APN	5	151062844	missense	probably damaging	1.00
IGL02294:Stard13	APN	5	151063115	missense	probably benign	0.19
IGL02713:Stard13	APN	5	151042186	nonsense	probably null
IGL02746:Stard13	APN	5	151046857	splice site	probably benign
IGL02827:Stard13	APN	5	151063126	missense	probably benign	0.07
R0498:Stard13	UTSW	5	151052477	missense	probably damaging	1.00
R1427:Stard13	UTSW	5	151045991	missense	probably damaging	0.99
R1785:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R1857:Stard13	UTSW	5	151095438	missense	probably damaging	1.00
R1858:Stard13	UTSW	5	151095438	missense	probably damaging	1.00
R2130:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2131:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2132:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2133:Stard13	UTSW	5	151045168	missense	probably damaging	1.00
R2258:Stard13	UTSW	5	151039731	missense	probably damaging	1.00
R3435:Stard13	UTSW	5	151042179	missense	probably damaging	1.00
R4080:Stard13	UTSW	5	151092829	critical splice acceptor site	probably null
R4081:Stard13	UTSW	5	151092829	critical splice acceptor site	probably null
R4082:Stard13	UTSW	5	151092829	critical splice acceptor site	probably null
R4233:Stard13	UTSW	5	151062699	missense	probably benign	0.00
R4288:Stard13	UTSW	5	151045177	missense	probably damaging	1.00
R4303:Stard13	UTSW	5	151062869	missense	possibly damaging	0.82
R4659:Stard13	UTSW	5	151062788	missense	probably benign	0.01
R4695:Stard13	UTSW	5	151060815	missense	probably benign	0.08
R4910:Stard13	UTSW	5	151062527	missense	probably benign
R5135:Stard13	UTSW	5	151062767	nonsense	probably null
R5338:Stard13	UTSW	5	151059598	missense	probably damaging	1.00
R5399:Stard13	UTSW	5	151047801	nonsense	probably null
R5546:Stard13	UTSW	5	151045901	missense	probably benign	0.03
R5685:Stard13	UTSW	5	151063127	missense	possibly damaging	0.78
R5771:Stard13	UTSW	5	151190011	missense	probably damaging	1.00
R6034:Stard13	UTSW	5	151095500	splice site	probably null
R6034:Stard13	UTSW	5	151095500	splice site	probably null
R6141:Stard13	UTSW	5	151042242	missense	probably damaging	1.00
R6171:Stard13	UTSW	5	151092762	missense	probably damaging	1.00
R6326:Stard13	UTSW	5	151046919	missense	possibly damaging	0.95
R6508:Stard13	UTSW	5	151063289	missense	probably benign	0.06
R7252:Stard13	UTSW	5	151063169	missense	probably benign	0.01
R7318:Stard13	UTSW	5	151062573	nonsense	probably null
R7459:Stard13	UTSW	5	151047599	missense	probably damaging	1.00
R7571:Stard13	UTSW	5	151059502	missense	probably damaging	0.97
R7696:Stard13	UTSW	5	151060802	missense	probably damaging	0.99
R7809:Stard13	UTSW	5	151190024	missense	probably damaging	0.98
R7962:Stard13	UTSW	5	151052373	missense	probably damaging	0.99
R7970:Stard13	UTSW	5	151063261	missense	possibly damaging	0.83
R8103:Stard13	UTSW	5	151046970	missense	possibly damaging	0.92
R8113:Stard13	UTSW	5	151063505	missense	probably damaging	0.99
R8263:Stard13	UTSW	5	151233641	missense	possibly damaging	0.81
R8392:Stard13	UTSW	5	151042162	missense	probably benign	0.24
R8490:Stard13	UTSW	5	151063625	missense	probably damaging	1.00
R8726:Stard13	UTSW	5	151063142	missense	probably benign	0.28
Z1177:Stard13	UTSW	5	151063334	missense	probably benign	0.18

Predicted Primers

PCR Primer
(F):5'- AATGTGCTGTGACTTTGCAG -3'
(R):5'- CATGCATGGGTTTCACTCCC -3'

Sequencing Primer
(F):5'- ACTTTGCAGTTCGGGTAAGATG -3'
(R):5'- GAAAACTTGGTGGTCCACATTCC -3'

Posted On

2018-04-02