Incidental Mutation 'R6296:Kcnc1'
ID508766
Institutional Source Beutler Lab
Gene Symbol Kcnc1
Ensembl Gene ENSMUSG00000058975
Gene Namepotassium voltage gated channel, Shaw-related subfamily, member 1
SynonymsKv3.1, C230009H10Rik, Kcr2-1, KShIIIB, NGK2, KV4, Shaw
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R6296 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location46396497-46438704 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 46435316 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 555 (A555T)
Ref Sequence ENSEMBL: ENSMUSP00000124938 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025202] [ENSMUST00000160433]
Predicted Effect probably benign
Transcript: ENSMUST00000025202
SMART Domains Protein: ENSMUSP00000025202
Gene: ENSMUSG00000058975

DomainStartEndE-ValueType
BTB 8 112 2.29e-15 SMART
low complexity region 125 149 N/A INTRINSIC
Pfam:Ion_trans 247 435 2.8e-34 PFAM
Pfam:Ion_trans_2 346 440 1.5e-12 PFAM
low complexity region 449 464 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000160433
AA Change: A555T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000124938
Gene: ENSMUSG00000058975
AA Change: A555T

DomainStartEndE-ValueType
BTB 8 112 2.29e-15 SMART
low complexity region 125 149 N/A INTRINSIC
Pfam:Ion_trans 189 447 6.9e-47 PFAM
Pfam:Ion_trans_2 347 440 1.4e-12 PFAM
low complexity region 449 464 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a family of integral membrane proteins that mediate the voltage-dependent potassium ion permeability of excitable membranes. Alternative splicing is thought to result in two transcript variants encoding isoforms that differ at their C-termini. These isoforms have had conflicting names in the literature: the longer isoform has been called both "b" and "alpha", while the shorter isoform has been called both "a" and "beta" (PMIDs 1432046, 12091563). [provided by RefSeq, Oct 2014]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
5730559C18Rik C T 1: 136,221,071 probably null Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Adcy5 A G 16: 35,303,710 Y1253C probably damaging Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Adm A G 7: 110,628,354 T26A probably benign Het
Ahnak T G 19: 9,003,305 V651G probably damaging Het
Akr7a5 G A 4: 139,318,221 V358I probably benign Het
Ankar T G 1: 72,643,258 T1383P probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cacna1h G A 17: 25,383,079 R1596C probably damaging Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Cfap54 T C 10: 93,066,846 Y148C probably damaging Het
Coa5 A G 1: 37,428,347 S60P probably damaging Het
Col6a2 T C 10: 76,611,049 N342D probably damaging Het
Cyp2c29 T G 19: 39,330,261 I434S possibly damaging Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dusp16 C A 6: 134,720,493 probably null Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Epn1 G A 7: 5,090,123 A145T probably damaging Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Gm6358 T C 16: 89,141,082 S70P unknown Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hsfy2 T A 1: 56,637,192 H62L probably benign Het
Ighm T C 12: 113,421,567 I258V unknown Het
Igkv13-71-1 G T 6: 69,235,799 noncoding transcript Het
Irx1 A C 13: 71,959,668 S298R probably damaging Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lipo1 T C 19: 33,780,337 D244G probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Macf1 A T 4: 123,432,875 I4943N probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr209 T C 16: 59,361,406 K271E probably benign Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pbx1 T C 1: 168,183,615 D372G possibly damaging Het
Pikfyve T A 1: 65,262,953 S1668T probably damaging Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Plag1 G T 4: 3,904,499 H231N probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Ptpn23 A T 9: 110,393,826 N54K probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rassf9 T A 10: 102,545,753 I332N probably damaging Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rnf214 A G 9: 45,867,821 S389P probably benign Het
Rxfp1 A C 3: 79,667,848 L181R probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Sh3bp4 C A 1: 89,145,489 S686R probably damaging Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stard13 A T 5: 151,062,673 S339R probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tinag T A 9: 76,996,935 E402V possibly damaging Het
Tmem183a T C 1: 134,361,611 D27G probably damaging Het
Tnfrsf13c T C 15: 82,223,902 T56A probably damaging Het
Tnrc18 A C 5: 142,733,576 L1985R unknown Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Ufl1 G T 4: 25,270,572 Q215K probably benign Het
Unkl T C 17: 25,231,865 *232R probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Xkr4 T C 1: 3,216,570 T466A probably benign Het
Zfp451 T A 1: 33,769,817 K988* probably null Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Kcnc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01575:Kcnc1 APN 7 46428099 missense possibly damaging 0.95
IGL01860:Kcnc1 APN 7 46428130 missense probably damaging 1.00
IGL02075:Kcnc1 APN 7 46427973 missense probably damaging 1.00
IGL02478:Kcnc1 APN 7 46435169 missense probably benign 0.18
Evanescent UTSW 7 46427959 missense probably damaging 1.00
Subtilis UTSW 7 46427821 missense probably damaging 1.00
wispy UTSW 7 46427397 missense probably damaging 1.00
R1438:Kcnc1 UTSW 7 46428267 missense possibly damaging 0.81
R1487:Kcnc1 UTSW 7 46397874 missense possibly damaging 0.88
R1487:Kcnc1 UTSW 7 46435348 critical splice donor site probably null
R1595:Kcnc1 UTSW 7 46427586 missense probably benign 0.03
R2273:Kcnc1 UTSW 7 46427802 missense probably damaging 1.00
R2345:Kcnc1 UTSW 7 46397946 missense probably damaging 1.00
R4126:Kcnc1 UTSW 7 46398002 missense probably damaging 0.98
R4387:Kcnc1 UTSW 7 46397702 missense possibly damaging 0.89
R4388:Kcnc1 UTSW 7 46397702 missense possibly damaging 0.89
R4508:Kcnc1 UTSW 7 46428288 missense probably benign 0.15
R4688:Kcnc1 UTSW 7 46397835 missense probably benign 0.01
R4784:Kcnc1 UTSW 7 46437287 missense probably benign 0.00
R5293:Kcnc1 UTSW 7 46397811 missense probably benign 0.01
R5993:Kcnc1 UTSW 7 46427532 missense probably damaging 1.00
R6512:Kcnc1 UTSW 7 46427397 missense probably damaging 1.00
R6678:Kcnc1 UTSW 7 46397805 missense probably benign 0.30
R6801:Kcnc1 UTSW 7 46435292 missense probably damaging 0.99
R7232:Kcnc1 UTSW 7 46427959 missense probably damaging 1.00
R7886:Kcnc1 UTSW 7 46427621 missense probably damaging 1.00
R7899:Kcnc1 UTSW 7 46427821 missense probably damaging 1.00
R7998:Kcnc1 UTSW 7 46397799 missense probably benign 0.01
X0022:Kcnc1 UTSW 7 46435240 missense probably benign
X0054:Kcnc1 UTSW 7 46397892 missense probably damaging 1.00
Y5406:Kcnc1 UTSW 7 46427379 missense probably benign 0.00
Z1177:Kcnc1 UTSW 7 46397852 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTCGGTGTCTCAATAGCTTCTG -3'
(R):5'- CCCTTGGAGAAAGAACTCTGAC -3'

Sequencing Primer
(F):5'- GCTTCTGCTTATATGTTTGAAGATTC -3'
(R):5'- TGACTTCTAGAGGCGAATCTCCAG -3'
Posted On2018-04-02