Mutagenetix > Incidental Mutations

Incidental Mutation 'R6296:Nek1'

508768

Institutional Source

Beutler Lab

Gene Symbol

Nek1

Ensembl Gene

ENSMUSG00000031644

Gene Name

NIMA (never in mitosis gene a)-related expressed kinase 1

Synonyms

kidney, anemia and testis, kat, D8Ertd790e

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_175089.3; MGI: 97303

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6296 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

60993195-61131346 bp(+) (GRCm38)

Type of Mutation

nonsense

DNA Base Change (assembly)

C to T at 61072309 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Glutamine to Stop codon at position 594 (Q594*)

Ref Sequence

ENSEMBL: ENSMUSP00000147809 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000034065] [ENSMUST00000120689] [ENSMUST00000211256] [ENSMUST00000211672]

AlphaFold

P51954

Predicted Effect

probably null
Transcript: ENSMUST00000034065
AA Change: Q522*

SMART Domains

Protein: ENSMUSP00000034065
Gene: ENSMUSG00000031644
AA Change: Q522*

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	556	592	N/A	INTRINSIC
coiled coil region	647	685	N/A	INTRINSIC
low complexity region	767	780	N/A	INTRINSIC
low complexity region	1130	1141	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000120689
AA Change: Q550*

SMART Domains

Protein: ENSMUSP00000113932
Gene: ENSMUSG00000031644
AA Change: Q550*

Domain	Start	End	E-Value	Type
S_TKc	4	258	4.23e-95	SMART
Blast:S_TKc	266	303	3e-7	BLAST
low complexity region	321	337	N/A	INTRINSIC
coiled coil region	372	402	N/A	INTRINSIC
coiled coil region	487	510	N/A	INTRINSIC
low complexity region	521	533	N/A	INTRINSIC
coiled coil region	584	620	N/A	INTRINSIC
coiled coil region	675	713	N/A	INTRINSIC
low complexity region	795	808	N/A	INTRINSIC
low complexity region	1158	1169	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000142601

SMART Domains

Protein: ENSMUSP00000121479
Gene: ENSMUSG00000031644

Domain	Start	End	E-Value	Type
low complexity region	38	47	N/A	INTRINSIC
coiled coil region	162	198	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000155664

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000209845

Predicted Effect

probably null
Transcript: ENSMUST00000211256
AA Change: Q497*

Predicted Effect

probably null
Transcript: ENSMUST00000211672
AA Change: Q594*

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

Strain: 1858030; 1858122
Lethality: D14-D365
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a serine/threonine kinase involved in cell cycle regulation. The encoded protein is found in a centrosomal complex with FEZ1, a neuronal protein that plays a role in axonal development. Defects in this gene are a cause of polycystic kidney disease (PKD). Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Spontaneous mutations of this gene result in pleiotropic effects that include facial dysmorphism, dwarfism, male sterility, anemia, cystic choroid plexus, a late-onset slowly progressive polycystic kidney disease, and premature death. Postnatal survival is sensitive to genetic background. [provided by MGI curators]

Allele List at MGI

All alleles(4) : Targeted(1) Gene trapped(1) Spontaneous(2)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,683	D441G	probably benign	Het
4933427D14Rik	T	C	11: 72,195,754	K277R	probably damaging	Het
5730559C18Rik	C	T	1: 136,221,071		probably null	Het
Aatf	T	C	11: 84,473,100	Y267C	probably benign	Het
Adcy5	A	G	16: 35,303,710	Y1253C	probably damaging	Het
Adgra3	G	A	5: 49,960,847	P1120S	probably benign	Het
Adm	A	G	7: 110,628,354	T26A	probably benign	Het
Ahnak	T	G	19: 9,003,305	V651G	probably damaging	Het
Akr7a5	G	A	4: 139,318,221	V358I	probably benign	Het
Ankar	T	G	1: 72,643,258	T1383P	probably damaging	Het
Bpifb6	G	C	2: 153,906,892	K269N	possibly damaging	Het
Cacna1c	T	C	6: 118,598,723	E1927G	possibly damaging	Het
Cacna1c	T	A	6: 118,652,714	T1249S	probably benign	Het
Cacna1h	G	A	17: 25,383,079	R1596C	probably damaging	Het
Cbll1	A	G	12: 31,487,508	V415A	probably benign	Het
Cd300lf	C	T	11: 115,124,369	V132I	probably benign	Het
Cfap54	T	C	10: 93,066,846	Y148C	probably damaging	Het
Coa5	A	G	1: 37,428,347	S60P	probably damaging	Het
Col6a2	T	C	10: 76,611,049	N342D	probably damaging	Het
Cyp2c29	T	G	19: 39,330,261	I434S	possibly damaging	Het
Ddx11	G	A	17: 66,150,729		probably null	Het
Dgke	C	T	11: 89,040,749	V560I	probably benign	Het
Dusp16	C	A	6: 134,720,493		probably null	Het
Enpp4	G	T	17: 44,102,480	N54K	probably benign	Het
Epn1	G	A	7: 5,090,123	A145T	probably damaging	Het
Erc2	A	T	14: 28,080,155	K764M	probably damaging	Het
Ercc6	G	T	14: 32,526,403	E304*	probably null	Het
Fam117a	T	A	11: 95,364,145	C115S	possibly damaging	Het
Galntl5	T	C	5: 25,186,165	S21P	probably benign	Het
Gm6358	T	C	16: 89,141,082	S70P	unknown	Het
Grip1	C	T	10: 120,075,464	Q696*	probably null	Het
Haus5	C	T	7: 30,658,976	W298*	probably null	Het
Hsfy2	T	A	1: 56,637,192	H62L	probably benign	Het
Ighm	T	C	12: 113,421,567	I258V	unknown	Het
Igkv13-71-1	G	T	6: 69,235,799		noncoding transcript	Het
Irx1	A	C	13: 71,959,668	S298R	probably damaging	Het
Jarid2	T	A	13: 44,903,063	Y443N	possibly damaging	Het
Kcnc1	G	A	7: 46,435,316	A555T	probably benign	Het
Krtap4-6	T	A	11: 99,665,419	R161*	probably null	Het
Lipo1	T	C	19: 33,780,337	D244G	probably benign	Het
Lmo2	T	G	2: 103,970,601	V39G	possibly damaging	Het
Lrch2	C	T	X: 147,480,557	A369T	probably damaging	Homo
Macf1	A	T	4: 123,432,875	I4943N	probably damaging	Het
Mkx	A	T	18: 7,000,591		probably null	Het
Nipbl	T	C	15: 8,300,895	M2349V	possibly damaging	Het
Nup155	T	A	15: 8,153,155	C1201S	probably damaging	Het
Olfr1249	G	A	2: 89,630,631	T89I	probably damaging	Het
Olfr1373	C	A	11: 52,144,596	R311S	probably benign	Het
Olfr209	T	C	16: 59,361,406	K271E	probably benign	Het
Osbpl1a	A	G	18: 12,819,503		probably null	Het
Pbx1	T	C	1: 168,183,615	D372G	possibly damaging	Het
Pikfyve	T	A	1: 65,262,953	S1668T	probably damaging	Het
Pitpnc1	T	C	11: 107,226,266	H193R	probably damaging	Het
Plag1	G	T	4: 3,904,499	H231N	probably damaging	Het
Prmt8	A	G	6: 127,711,804	I201T	probably damaging	Het
Ptpn23	A	T	9: 110,393,826	N54K	probably damaging	Het
Rab11fip4	T	C	11: 79,690,829		probably null	Het
Rassf9	T	A	10: 102,545,753	I332N	probably damaging	Het
Rgs9	T	C	11: 109,268,987	N173S	probably benign	Het
Rhbdl1	A	G	17: 25,834,969	L309P	probably damaging	Het
Rnf214	A	G	9: 45,867,821	S389P	probably benign	Het
Rxfp1	A	C	3: 79,667,848	L181R	probably damaging	Het
Sfxn1	C	T	13: 54,093,880	T208I	probably benign	Het
Sgo2b	C	T	8: 63,927,793	M668I	probably benign	Het
Sh3bp4	C	A	1: 89,145,489	S686R	probably damaging	Het
Spata31d1d	G	A	13: 59,728,464	T419I	possibly damaging	Het
Spink5	T	C	18: 44,014,757	S857P	probably damaging	Het
Stard13	A	T	5: 151,062,673	S339R	probably damaging	Het
Stk35	T	A	2: 129,810,888	Y436*	probably null	Het
Supt6	C	T	11: 78,226,059	R589Q	possibly damaging	Het
Tinag	T	A	9: 76,996,935	E402V	possibly damaging	Het
Tmem183a	T	C	1: 134,361,611	D27G	probably damaging	Het
Tnfrsf13c	T	C	15: 82,223,902	T56A	probably damaging	Het
Tnrc18	A	C	5: 142,733,576	L1985R	unknown	Het
Ttn	G	A	2: 76,749,329	T23740M	probably damaging	Het
Ufl1	G	T	4: 25,270,572	Q215K	probably benign	Het
Unkl	T	C	17: 25,231,865	*232R	probably null	Het
Wnk4	A	T	11: 101,273,998	N718Y	probably damaging	Het
Xkr4	T	C	1: 3,216,570	T466A	probably benign	Het
Zfp451	T	A	1: 33,769,817	K988*	probably null	Het
Zfp503	G	C	14: 21,985,800	Y349*	probably null	Het
Zfp990	T	A	4: 145,538,103	F557Y	possibly damaging	Het

Other mutations in Nek1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00471:Nek1	APN	8	61043284	missense	probably benign	0.00
IGL01075:Nek1	APN	8	61124132	missense	possibly damaging	0.64
IGL01122:Nek1	APN	8	61120966	missense	possibly damaging	0.80
IGL01151:Nek1	APN	8	61020077	missense	probably damaging	1.00
IGL01286:Nek1	APN	8	61124216	missense	possibly damaging	0.64
IGL01377:Nek1	APN	8	61089456	missense	probably benign
IGL01485:Nek1	APN	8	61049826	missense	probably benign	0.02
IGL01688:Nek1	APN	8	61105597	nonsense	probably null
IGL01806:Nek1	APN	8	61124212	missense	possibly damaging	0.82
IGL02006:Nek1	APN	8	61104192	missense	probably benign	0.20
IGL02304:Nek1	APN	8	61012167	missense	probably damaging	1.00
IGL02659:Nek1	APN	8	61089480	missense	probably benign	0.16
IGL02662:Nek1	APN	8	61104184	missense	probably benign	0.00
IGL02801:Nek1	APN	8	61121061	critical splice donor site	probably null
IGL02806:Nek1	APN	8	61044086	missense	probably benign	0.15
IGL03037:Nek1	APN	8	61034052	missense	probably benign	0.16
IGL03252:Nek1	APN	8	61072330	nonsense	probably null
P0014:Nek1	UTSW	8	61071747	splice site	probably benign
R0019:Nek1	UTSW	8	61089734	missense	probably benign	0.01
R0403:Nek1	UTSW	8	61106855	missense	probably damaging	0.99
R0464:Nek1	UTSW	8	61072273	splice site	probably benign
R0726:Nek1	UTSW	8	61089592	missense	probably damaging	1.00
R0761:Nek1	UTSW	8	61089455	missense	probably benign
R0827:Nek1	UTSW	8	61105648	splice site	probably benign
R0972:Nek1	UTSW	8	61089431	splice site	probably null
R1268:Nek1	UTSW	8	61022264	missense	probably damaging	1.00
R1343:Nek1	UTSW	8	61028675	missense	probably damaging	1.00
R1415:Nek1	UTSW	8	61089686	missense	probably benign	0.00
R1466:Nek1	UTSW	8	61125136	splice site	probably benign
R1480:Nek1	UTSW	8	61124326	splice site	probably null
R1526:Nek1	UTSW	8	61049941	missense	probably benign	0.26
R1552:Nek1	UTSW	8	61006737	missense	probably damaging	0.99
R1606:Nek1	UTSW	8	61124276	missense	possibly damaging	0.82
R1650:Nek1	UTSW	8	61036076	missense	probably benign	0.00
R1757:Nek1	UTSW	8	61089813	splice site	probably null
R1808:Nek1	UTSW	8	61016230	missense	probably damaging	1.00
R1966:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R2067:Nek1	UTSW	8	61007162	missense	probably damaging	1.00
R2111:Nek1	UTSW	8	61124326	splice site	probably null
R2113:Nek1	UTSW	8	61016293	missense	probably damaging	1.00
R2143:Nek1	UTSW	8	61028696	missense	probably damaging	1.00
R2255:Nek1	UTSW	8	61089773	missense	probably damaging	1.00
R2422:Nek1	UTSW	8	61019901	missense	probably damaging	1.00
R3848:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3849:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R3850:Nek1	UTSW	8	61072315	missense	probably damaging	0.99
R4418:Nek1	UTSW	8	61106864	missense	probably damaging	1.00
R4526:Nek1	UTSW	8	61106944	missense	probably damaging	0.99
R4533:Nek1	UTSW	8	61007213	missense	possibly damaging	0.95
R4544:Nek1	UTSW	8	61016304	nonsense	probably null
R4677:Nek1	UTSW	8	61028806	missense	probably damaging	0.99
R4739:Nek1	UTSW	8	61098511	missense	probably benign	0.32
R5068:Nek1	UTSW	8	61016296	missense	probably damaging	1.00
R5421:Nek1	UTSW	8	61006677	missense	possibly damaging	0.81
R5516:Nek1	UTSW	8	61089489	missense	probably benign	0.03
R5855:Nek1	UTSW	8	61016272	missense	probably damaging	1.00
R6125:Nek1	UTSW	8	61028701	missense	probably damaging	1.00
R6267:Nek1	UTSW	8	61072309	nonsense	probably null
R6292:Nek1	UTSW	8	61054736	splice site	probably null
R6458:Nek1	UTSW	8	61100012	missense	probably benign	0.00
R6568:Nek1	UTSW	8	61106821	missense	probably benign	0.00
R6629:Nek1	UTSW	8	61054333	splice site	probably null
R6867:Nek1	UTSW	8	61072330	missense	possibly damaging	0.81
R7122:Nek1	UTSW	8	61106795	missense	probably benign	0.00
R7193:Nek1	UTSW	8	61073578	missense	probably damaging	0.99
R7272:Nek1	UTSW	8	61125086	missense	probably benign	0.34
R7356:Nek1	UTSW	8	61120960	missense	probably benign	0.02
R7368:Nek1	UTSW	8	61089707	missense	probably benign	0.24
R7478:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7479:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7512:Nek1	UTSW	8	61130145	missense	probably benign	0.03
R7715:Nek1	UTSW	8	61006760	missense	probably damaging	0.98
R7984:Nek1	UTSW	8	61121053	nonsense	probably null
R8271:Nek1	UTSW	8	61105612	missense	probably benign	0.04
R8431:Nek1	UTSW	8	61034032	missense	possibly damaging	0.95
R9076:Nek1	UTSW	8	61028734	missense	probably damaging	0.96
R9149:Nek1	UTSW	8	61121021	missense	probably damaging	1.00
R9250:Nek1	UTSW	8	61012117	missense	probably damaging	0.99
R9429:Nek1	UTSW	8	61106858	missense	probably benign
RF023:Nek1	UTSW	8	61072745	splice site	probably null
X0028:Nek1	UTSW	8	61043258	missense	probably benign	0.19
X0066:Nek1	UTSW	8	61125128	critical splice donor site	probably null

Predicted Primers

PCR Primer
(F):5'- GTGTCATAATTTTGCCCCATAACTG -3'
(R):5'- CTGGCAGTTTGAACTCCTTCAC -3'

Sequencing Primer
(F):5'- ATAATTTTGCCCCATAACTGTTACTC -3'
(R):5'- GGCAGTTTGAACTCCTTCACTTAAG -3'

Posted On

2018-04-02