Mutagenetix > Incidental Mutations

Incidental Mutation 'R6296:Aatf'

508781

Institutional Source

Beutler Lab

Gene Symbol

Aatf

Ensembl Gene

ENSMUSG00000018697

Gene Name

apoptosis antagonizing transcription factor

Synonyms

Trb, 4933415H02Rik, 5830465M17Rik, Che-1

MMRRC Submission

Accession Numbers

NCBI RefSeq: NM_019816.1; MGI:1929608

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6296 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

84422855-84513522 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 84473100 bp

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 267 (Y267C)

Ref Sequence

ENSEMBL: ENSMUSP00000018841 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018841]

Predicted Effect

probably benign
Transcript: ENSMUST00000018841
AA Change: Y267C

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000018841
Gene: ENSMUSG00000018697
AA Change: Y267C

Domain	Start	End	E-Value	Type
low complexity region	2	35	N/A	INTRINSIC
low complexity region	91	119	N/A	INTRINSIC
low complexity region	130	173	N/A	INTRINSIC
Pfam:AATF-Che1	187	339	4.6e-40	PFAM
low complexity region	418	429	N/A	INTRINSIC
Pfam:TRAUB	430	514	3.2e-29	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000127042

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000148434

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

Strain: 2176283
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene was identified on the basis of its interaction with MAP3K12/DLK, a protein kinase known to be involved in the induction of cell apoptosis. This gene product contains a leucine zipper, which is a characteristic motif of transcription factors, and was shown to exhibit strong transactivation activity when fused to Gal4 DNA binding domain. Overexpression of this gene interfered with MAP3K12 induced apoptosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous embryos do not develop past the compacted morula stage, and after failing to maintain compaction. Mutant embryos show abnormal morphology at E3.5, with most not forming a blastocoel cavity. Severely reduced cell proliferation is observed before blastocyst formation. [provided by MGI curators]

Allele List at MGI

All alleles(20) : Targeted(2) Gene trapped(18)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,683	D441G	probably benign	Het
4933427D14Rik	T	C	11: 72,195,754	K277R	probably damaging	Het
5730559C18Rik	C	T	1: 136,221,071		probably null	Het
Adcy5	A	G	16: 35,303,710	Y1253C	probably damaging	Het
Adgra3	G	A	5: 49,960,847	P1120S	probably benign	Het
Adm	A	G	7: 110,628,354	T26A	probably benign	Het
Ahnak	T	G	19: 9,003,305	V651G	probably damaging	Het
Akr7a5	G	A	4: 139,318,221	V358I	probably benign	Het
Ankar	T	G	1: 72,643,258	T1383P	probably damaging	Het
Bpifb6	G	C	2: 153,906,892	K269N	possibly damaging	Het
Cacna1c	T	C	6: 118,598,723	E1927G	possibly damaging	Het
Cacna1c	T	A	6: 118,652,714	T1249S	probably benign	Het
Cacna1h	G	A	17: 25,383,079	R1596C	probably damaging	Het
Cbll1	A	G	12: 31,487,508	V415A	probably benign	Het
Cd300lf	C	T	11: 115,124,369	V132I	probably benign	Het
Cfap54	T	C	10: 93,066,846	Y148C	probably damaging	Het
Coa5	A	G	1: 37,428,347	S60P	probably damaging	Het
Col6a2	T	C	10: 76,611,049	N342D	probably damaging	Het
Cyp2c29	T	G	19: 39,330,261	I434S	possibly damaging	Het
Ddx11	G	A	17: 66,150,729		probably null	Het
Dgke	C	T	11: 89,040,749	V560I	probably benign	Het
Dusp16	C	A	6: 134,720,493		probably null	Het
Enpp4	G	T	17: 44,102,480	N54K	probably benign	Het
Epn1	G	A	7: 5,090,123	A145T	probably damaging	Het
Erc2	A	T	14: 28,080,155	K764M	probably damaging	Het
Ercc6	G	T	14: 32,526,403	E304*	probably null	Het
Fam117a	T	A	11: 95,364,145	C115S	possibly damaging	Het
Galntl5	T	C	5: 25,186,165	S21P	probably benign	Het
Gm6358	T	C	16: 89,141,082	S70P	unknown	Het
Grip1	C	T	10: 120,075,464	Q696*	probably null	Het
Haus5	C	T	7: 30,658,976	W298*	probably null	Het
Hsfy2	T	A	1: 56,637,192	H62L	probably benign	Het
Ighm	T	C	12: 113,421,567	I258V	unknown	Het
Igkv13-71-1	G	T	6: 69,235,799		noncoding transcript	Het
Irx1	A	C	13: 71,959,668	S298R	probably damaging	Het
Jarid2	T	A	13: 44,903,063	Y443N	possibly damaging	Het
Kcnc1	G	A	7: 46,435,316	A555T	probably benign	Het
Krtap4-6	T	A	11: 99,665,419	R161*	probably null	Het
Lipo1	T	C	19: 33,780,337	D244G	probably benign	Het
Lmo2	T	G	2: 103,970,601	V39G	possibly damaging	Het
Lrch2	C	T	X: 147,480,557	A369T	probably damaging	Homo
Macf1	A	T	4: 123,432,875	I4943N	probably damaging	Het
Mkx	A	T	18: 7,000,591		probably null	Het
Nek1	C	T	8: 61,072,309	Q594*	probably null	Het
Nipbl	T	C	15: 8,300,895	M2349V	possibly damaging	Het
Nup155	T	A	15: 8,153,155	C1201S	probably damaging	Het
Olfr1249	G	A	2: 89,630,631	T89I	probably damaging	Het
Olfr1373	C	A	11: 52,144,596	R311S	probably benign	Het
Olfr209	T	C	16: 59,361,406	K271E	probably benign	Het
Osbpl1a	A	G	18: 12,819,503		probably null	Het
Pbx1	T	C	1: 168,183,615	D372G	possibly damaging	Het
Pikfyve	T	A	1: 65,262,953	S1668T	probably damaging	Het
Pitpnc1	T	C	11: 107,226,266	H193R	probably damaging	Het
Plag1	G	T	4: 3,904,499	H231N	probably damaging	Het
Prmt8	A	G	6: 127,711,804	I201T	probably damaging	Het
Ptpn23	A	T	9: 110,393,826	N54K	probably damaging	Het
Rab11fip4	T	C	11: 79,690,829		probably null	Het
Rassf9	T	A	10: 102,545,753	I332N	probably damaging	Het
Rgs9	T	C	11: 109,268,987	N173S	probably benign	Het
Rhbdl1	A	G	17: 25,834,969	L309P	probably damaging	Het
Rnf214	A	G	9: 45,867,821	S389P	probably benign	Het
Rxfp1	A	C	3: 79,667,848	L181R	probably damaging	Het
Sfxn1	C	T	13: 54,093,880	T208I	probably benign	Het
Sgo2b	C	T	8: 63,927,793	M668I	probably benign	Het
Sh3bp4	C	A	1: 89,145,489	S686R	probably damaging	Het
Spata31d1d	G	A	13: 59,728,464	T419I	possibly damaging	Het
Spink5	T	C	18: 44,014,757	S857P	probably damaging	Het
Stard13	A	T	5: 151,062,673	S339R	probably damaging	Het
Stk35	T	A	2: 129,810,888	Y436*	probably null	Het
Supt6	C	T	11: 78,226,059	R589Q	possibly damaging	Het
Tinag	T	A	9: 76,996,935	E402V	possibly damaging	Het
Tmem183a	T	C	1: 134,361,611	D27G	probably damaging	Het
Tnfrsf13c	T	C	15: 82,223,902	T56A	probably damaging	Het
Tnrc18	A	C	5: 142,733,576	L1985R	unknown	Het
Ttn	G	A	2: 76,749,329	T23740M	probably damaging	Het
Ufl1	G	T	4: 25,270,572	Q215K	probably benign	Het
Unkl	T	C	17: 25,231,865	*232R	probably null	Het
Wnk4	A	T	11: 101,273,998	N718Y	probably damaging	Het
Xkr4	T	C	1: 3,216,570	T466A	probably benign	Het
Zfp451	T	A	1: 33,769,817	K988*	probably null	Het
Zfp503	G	C	14: 21,985,800	Y349*	probably null	Het
Zfp990	T	A	4: 145,538,103	F557Y	possibly damaging	Het

Other mutations in Aatf

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00900:Aatf	APN	11	84470557	splice site	probably benign
IGL01482:Aatf	APN	11	84470710	missense	possibly damaging	0.51
IGL01775:Aatf	APN	11	84471137	missense	probably damaging	1.00
IGL02881:Aatf	APN	11	84471289	splice site	probably benign
R0183:Aatf	UTSW	11	84510425	splice site	probably null
R0200:Aatf	UTSW	11	84445676	missense	probably damaging	1.00
R0257:Aatf	UTSW	11	84510281	missense	probably benign	0.33
R0324:Aatf	UTSW	11	84512139	critical splice donor site	probably null
R0494:Aatf	UTSW	11	84511513	missense	probably benign
R0544:Aatf	UTSW	11	84423005	missense	probably benign	0.09
R1186:Aatf	UTSW	11	84470549	splice site	probably benign
R2339:Aatf	UTSW	11	84511497	missense	probably benign	0.00
R4626:Aatf	UTSW	11	84422958	makesense	probably null
R4647:Aatf	UTSW	11	84471197	missense	possibly damaging	0.69
R4697:Aatf	UTSW	11	84449138	missense	probably damaging	1.00
R4981:Aatf	UTSW	11	84511497	missense	probably benign	0.00
R5490:Aatf	UTSW	11	84510273	missense	probably damaging	1.00
R5938:Aatf	UTSW	11	84442574	missense	possibly damaging	0.88
R6267:Aatf	UTSW	11	84473100	missense	probably benign	0.09
R6633:Aatf	UTSW	11	84511482	critical splice donor site	probably null
R7081:Aatf	UTSW	11	84471125	missense	possibly damaging	0.84
R7212:Aatf	UTSW	11	84449180	missense	probably damaging	0.98
R7545:Aatf	UTSW	11	84470676	missense	probably benign	0.04
R7754:Aatf	UTSW	11	84511509	missense	possibly damaging	0.53
R7871:Aatf	UTSW	11	84471038	frame shift	probably null
R8411:Aatf	UTSW	11	84470676	missense	probably benign	0.04
X0018:Aatf	UTSW	11	84510385	missense	possibly damaging	0.85
Z1176:Aatf	UTSW	11	84442585	missense	probably benign	0.01

Predicted Primers

PCR Primer
(F):5'- AAACTGTCCTGTTCTGACCACC -3'
(R):5'- GGCACTGGAGTAGTTTCCATG -3'

Sequencing Primer
(F):5'- CTGACCACCTGTTAAATATAAAAGCG -3'
(R):5'- CCATGGAGTTGATCTCAGAAAGTAC -3'

Posted On

2018-04-02