Mutagenetix > Incidental Mutations

Incidental Mutation 'R6296:Nup155'

508799

Institutional Source

Beutler Lab

Gene Symbol

Nup155

Ensembl Gene

ENSMUSG00000022142

Gene Name

nucleoporin 155

Synonyms

D930027M19Rik

MMRRC Submission

Accession Numbers

Genbank: NM_133227

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R6296 (G1)

Quality Score

225.009

Status

Not validated

Chromosome

Chromosomal Location

8109273-8161247 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to A at 8153155 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Cysteine to Serine at position 1201 (C1201S)

Ref Sequence

ENSEMBL: ENSMUSP00000155093 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163765] [ENSMUST00000230017]

AlphaFold

Q99P88

Predicted Effect

probably damaging
Transcript: ENSMUST00000163765
AA Change: C1201S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000128819
Gene: ENSMUSG00000022142
AA Change: C1201S

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
Pfam:Nucleoporin_N	77	510	3.5e-105	PFAM
low complexity region	600	619	N/A	INTRINSIC
Pfam:Nucleoporin_C	678	1221	3.6e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000230017
AA Change: C1201S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230647

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000230925

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E8.5. Mice homozygous for a gene trap allele exhibit atria fibrillation associated with shortened action potential duration. [provided by MGI curators]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 82 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700014D04Rik	T	C	13: 59,742,683	D441G	probably benign	Het
4933427D14Rik	T	C	11: 72,195,754	K277R	probably damaging	Het
5730559C18Rik	C	T	1: 136,221,071		probably null	Het
Aatf	T	C	11: 84,473,100	Y267C	probably benign	Het
Adcy5	A	G	16: 35,303,710	Y1253C	probably damaging	Het
Adgra3	G	A	5: 49,960,847	P1120S	probably benign	Het
Adm	A	G	7: 110,628,354	T26A	probably benign	Het
Ahnak	T	G	19: 9,003,305	V651G	probably damaging	Het
Akr7a5	G	A	4: 139,318,221	V358I	probably benign	Het
Ankar	T	G	1: 72,643,258	T1383P	probably damaging	Het
Bpifb6	G	C	2: 153,906,892	K269N	possibly damaging	Het
Cacna1c	T	C	6: 118,598,723	E1927G	possibly damaging	Het
Cacna1c	T	A	6: 118,652,714	T1249S	probably benign	Het
Cacna1h	G	A	17: 25,383,079	R1596C	probably damaging	Het
Cbll1	A	G	12: 31,487,508	V415A	probably benign	Het
Cd300lf	C	T	11: 115,124,369	V132I	probably benign	Het
Cfap54	T	C	10: 93,066,846	Y148C	probably damaging	Het
Coa5	A	G	1: 37,428,347	S60P	probably damaging	Het
Col6a2	T	C	10: 76,611,049	N342D	probably damaging	Het
Cyp2c29	T	G	19: 39,330,261	I434S	possibly damaging	Het
Ddx11	G	A	17: 66,150,729		probably null	Het
Dgke	C	T	11: 89,040,749	V560I	probably benign	Het
Dusp16	C	A	6: 134,720,493		probably null	Het
Enpp4	G	T	17: 44,102,480	N54K	probably benign	Het
Epn1	G	A	7: 5,090,123	A145T	probably damaging	Het
Erc2	A	T	14: 28,080,155	K764M	probably damaging	Het
Ercc6	G	T	14: 32,526,403	E304*	probably null	Het
Fam117a	T	A	11: 95,364,145	C115S	possibly damaging	Het
Galntl5	T	C	5: 25,186,165	S21P	probably benign	Het
Gm6358	T	C	16: 89,141,082	S70P	unknown	Het
Grip1	C	T	10: 120,075,464	Q696*	probably null	Het
Haus5	C	T	7: 30,658,976	W298*	probably null	Het
Hsfy2	T	A	1: 56,637,192	H62L	probably benign	Het
Ighm	T	C	12: 113,421,567	I258V	unknown	Het
Igkv13-71-1	G	T	6: 69,235,799		noncoding transcript	Het
Irx1	A	C	13: 71,959,668	S298R	probably damaging	Het
Jarid2	T	A	13: 44,903,063	Y443N	possibly damaging	Het
Kcnc1	G	A	7: 46,435,316	A555T	probably benign	Het
Krtap4-6	T	A	11: 99,665,419	R161*	probably null	Het
Lipo1	T	C	19: 33,780,337	D244G	probably benign	Het
Lmo2	T	G	2: 103,970,601	V39G	possibly damaging	Het
Lrch2	C	T	X: 147,480,557	A369T	probably damaging	Homo
Macf1	A	T	4: 123,432,875	I4943N	probably damaging	Het
Mkx	A	T	18: 7,000,591		probably null	Het
Nek1	C	T	8: 61,072,309	Q594*	probably null	Het
Nipbl	T	C	15: 8,300,895	M2349V	possibly damaging	Het
Olfr1249	G	A	2: 89,630,631	T89I	probably damaging	Het
Olfr1373	C	A	11: 52,144,596	R311S	probably benign	Het
Olfr209	T	C	16: 59,361,406	K271E	probably benign	Het
Osbpl1a	A	G	18: 12,819,503		probably null	Het
Pbx1	T	C	1: 168,183,615	D372G	possibly damaging	Het
Pikfyve	T	A	1: 65,262,953	S1668T	probably damaging	Het
Pitpnc1	T	C	11: 107,226,266	H193R	probably damaging	Het
Plag1	G	T	4: 3,904,499	H231N	probably damaging	Het
Prmt8	A	G	6: 127,711,804	I201T	probably damaging	Het
Ptpn23	A	T	9: 110,393,826	N54K	probably damaging	Het
Rab11fip4	T	C	11: 79,690,829		probably null	Het
Rassf9	T	A	10: 102,545,753	I332N	probably damaging	Het
Rgs9	T	C	11: 109,268,987	N173S	probably benign	Het
Rhbdl1	A	G	17: 25,834,969	L309P	probably damaging	Het
Rnf214	A	G	9: 45,867,821	S389P	probably benign	Het
Rxfp1	A	C	3: 79,667,848	L181R	probably damaging	Het
Sfxn1	C	T	13: 54,093,880	T208I	probably benign	Het
Sgo2b	C	T	8: 63,927,793	M668I	probably benign	Het
Sh3bp4	C	A	1: 89,145,489	S686R	probably damaging	Het
Spata31d1d	G	A	13: 59,728,464	T419I	possibly damaging	Het
Spink5	T	C	18: 44,014,757	S857P	probably damaging	Het
Stard13	A	T	5: 151,062,673	S339R	probably damaging	Het
Stk35	T	A	2: 129,810,888	Y436*	probably null	Het
Supt6	C	T	11: 78,226,059	R589Q	possibly damaging	Het
Tinag	T	A	9: 76,996,935	E402V	possibly damaging	Het
Tmem183a	T	C	1: 134,361,611	D27G	probably damaging	Het
Tnfrsf13c	T	C	15: 82,223,902	T56A	probably damaging	Het
Tnrc18	A	C	5: 142,733,576	L1985R	unknown	Het
Ttn	G	A	2: 76,749,329	T23740M	probably damaging	Het
Ufl1	G	T	4: 25,270,572	Q215K	probably benign	Het
Unkl	T	C	17: 25,231,865	*232R	probably null	Het
Wnk4	A	T	11: 101,273,998	N718Y	probably damaging	Het
Xkr4	T	C	1: 3,216,570	T466A	probably benign	Het
Zfp451	T	A	1: 33,769,817	K988*	probably null	Het
Zfp503	G	C	14: 21,985,800	Y349*	probably null	Het
Zfp990	T	A	4: 145,538,103	F557Y	possibly damaging	Het

Other mutations in Nup155

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Nup155	APN	15	8121455	splice site	probably benign
IGL00426:Nup155	APN	15	8156794	makesense	probably null
IGL00765:Nup155	APN	15	8153228	missense	probably benign	0.16
IGL00936:Nup155	APN	15	8128405	splice site	probably benign
IGL01124:Nup155	APN	15	8153679	missense	probably damaging	0.97
IGL01739:Nup155	APN	15	8135788	missense	probably benign	0.01
IGL02013:Nup155	APN	15	8113648	missense	possibly damaging	0.61
IGL02066:Nup155	APN	15	8157766	unclassified	probably benign
IGL02231:Nup155	APN	15	8144064	missense	probably damaging	1.00
IGL02246:Nup155	APN	15	8143002	missense	probably benign
IGL02289:Nup155	APN	15	8131493	missense	probably damaging	1.00
IGL02608:Nup155	APN	15	8109471	missense	probably benign
IGL02749:Nup155	APN	15	8134076	missense	probably damaging	1.00
IGL02813:Nup155	APN	15	8130121	splice site	probably benign
IGL03102:Nup155	APN	15	8147284	missense	probably benign	0.00
H8930:Nup155	UTSW	15	8157658	missense	possibly damaging	0.50
IGL02835:Nup155	UTSW	15	8143130	missense	probably damaging	1.00
R0314:Nup155	UTSW	15	8147252	missense	probably benign	0.00
R0365:Nup155	UTSW	15	8131543	missense	probably damaging	1.00
R0586:Nup155	UTSW	15	8130232	missense	probably benign	0.39
R0764:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R0839:Nup155	UTSW	15	8145587	missense	possibly damaging	0.48
R0844:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1066:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1067:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1085:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1137:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1162:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1166:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1202:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1203:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1219:Nup155	UTSW	15	8117338	missense	possibly damaging	0.80
R1385:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1421:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1448:Nup155	UTSW	15	8112406	missense	probably benign	0.44
R1611:Nup155	UTSW	15	8130160	missense	probably damaging	1.00
R1836:Nup155	UTSW	15	8154980	missense	possibly damaging	0.79
R1863:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1866:Nup155	UTSW	15	8115526	missense	probably damaging	1.00
R1894:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1976:Nup155	UTSW	15	8135827	missense	probably benign	0.01
R2024:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R2026:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R2027:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R2077:Nup155	UTSW	15	8143026	missense	probably damaging	1.00
R2111:Nup155	UTSW	15	8121467	missense	probably benign	0.45
R2921:Nup155	UTSW	15	8153641	missense	probably damaging	1.00
R2936:Nup155	UTSW	15	8143049	missense	possibly damaging	0.89
R3108:Nup155	UTSW	15	8117306	missense	probably null	1.00
R3161:Nup155	UTSW	15	8148383	missense	possibly damaging	0.56
R3162:Nup155	UTSW	15	8148383	missense	possibly damaging	0.56
R3162:Nup155	UTSW	15	8148383	missense	possibly damaging	0.56
R3522:Nup155	UTSW	15	8156678	splice site	probably benign
R4423:Nup155	UTSW	15	8121464	missense	probably damaging	0.99
R4451:Nup155	UTSW	15	8150882	missense	probably benign	0.02
R4498:Nup155	UTSW	15	8153673	missense	possibly damaging	0.88
R4780:Nup155	UTSW	15	8157703	missense	probably benign	0.00
R4822:Nup155	UTSW	15	8128526	missense	possibly damaging	0.49
R5013:Nup155	UTSW	15	8124238	missense	probably benign	0.00
R5064:Nup155	UTSW	15	8135870	missense	probably damaging	1.00
R5172:Nup155	UTSW	15	8109542	missense	probably benign	0.06
R5406:Nup155	UTSW	15	8153638	critical splice acceptor site	probably null
R5551:Nup155	UTSW	15	8148333	missense	probably benign	0.09
R5588:Nup155	UTSW	15	8119253	critical splice donor site	probably null
R5977:Nup155	UTSW	15	8130237	critical splice donor site	probably null
R6035:Nup155	UTSW	15	8144093	missense	probably benign
R6035:Nup155	UTSW	15	8144093	missense	probably benign
R6036:Nup155	UTSW	15	8128411	missense	probably benign	0.16
R6036:Nup155	UTSW	15	8128411	missense	probably benign	0.16
R6085:Nup155	UTSW	15	8148358	missense	probably damaging	0.98
R6188:Nup155	UTSW	15	8109575	missense	probably damaging	1.00
R6232:Nup155	UTSW	15	8109479	missense	probably benign	0.02
R6257:Nup155	UTSW	15	8150798	nonsense	probably null
R6262:Nup155	UTSW	15	8156741	missense	probably benign	0.03
R6267:Nup155	UTSW	15	8153155	missense	probably damaging	1.00
R6299:Nup155	UTSW	15	8128438	missense	possibly damaging	0.88
R6303:Nup155	UTSW	15	8118042	missense	probably damaging	1.00
R6304:Nup155	UTSW	15	8118042	missense	probably damaging	1.00
R6763:Nup155	UTSW	15	8135895	nonsense	probably null
R6958:Nup155	UTSW	15	8147154	missense	probably damaging	1.00
R7088:Nup155	UTSW	15	8156693	missense	probably benign	0.11
R7313:Nup155	UTSW	15	8154922	missense	probably damaging	0.96
R7451:Nup155	UTSW	15	8145607	nonsense	probably null
R7560:Nup155	UTSW	15	8155047	missense	probably benign	0.39
R7633:Nup155	UTSW	15	8109453	missense	probably damaging	0.99
R7670:Nup155	UTSW	15	8153696	missense	probably damaging	0.99
R7726:Nup155	UTSW	15	8122139	missense	probably damaging	1.00
R7752:Nup155	UTSW	15	8116442	missense	possibly damaging	0.53
R7889:Nup155	UTSW	15	8121507	missense	probably damaging	0.98
R7899:Nup155	UTSW	15	8119179	missense	probably damaging	1.00
R7901:Nup155	UTSW	15	8116442	missense	possibly damaging	0.53
R8429:Nup155	UTSW	15	8112420	missense	probably damaging	0.96
R8467:Nup155	UTSW	15	8121531	missense	probably benign	0.00
R8507:Nup155	UTSW	15	8147560	nonsense	probably null
R8860:Nup155	UTSW	15	8130156	missense	possibly damaging	0.96
R8994:Nup155	UTSW	15	8143161	critical splice donor site	probably null
R9046:Nup155	UTSW	15	8128435	frame shift	probably null
R9086:Nup155	UTSW	15	8148346	missense	possibly damaging	0.84
RF003:Nup155	UTSW	15	8119176	critical splice acceptor site	probably benign
RF048:Nup155	UTSW	15	8119176	critical splice acceptor site	probably benign
Z1177:Nup155	UTSW	15	8120489	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TTTAAACTGGGGTCCCATTCCC -3'
(R):5'- ACATAGCCCATTTCCATACTGC -3'

Sequencing Primer
(F):5'- GGGGTCCCATTCCCATTGC -3'
(R):5'- CTAGCAGCTTGTGTTCATTTGGATAC -3'

Posted On

2018-04-02