Incidental Mutation 'R6296:Nipbl'
ID 508800
Institutional Source Beutler Lab
Gene Symbol Nipbl
Ensembl Gene ENSMUSG00000022141
Gene Name NIPBL cohesin loading factor
Synonyms 4921518A06Rik, 4933421G18Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock # R6296 (G1)
Quality Score 225.009
Status Not validated
Chromosome 15
Chromosomal Location 8290617-8444463 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 8300895 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 2349 (M2349V)
Ref Sequence ENSEMBL: ENSMUSP00000059385 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052965]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000052965
AA Change: M2349V

PolyPhen 2 Score 0.456 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000059385
Gene: ENSMUSG00000022141
AA Change: M2349V

DomainStartEndE-ValueType
low complexity region 22 41 N/A INTRINSIC
low complexity region 322 338 N/A INTRINSIC
low complexity region 367 376 N/A INTRINSIC
low complexity region 447 462 N/A INTRINSIC
low complexity region 473 490 N/A INTRINSIC
low complexity region 639 652 N/A INTRINSIC
low complexity region 1020 1037 N/A INTRINSIC
low complexity region 1081 1097 N/A INTRINSIC
low complexity region 1102 1107 N/A INTRINSIC
low complexity region 1114 1139 N/A INTRINSIC
low complexity region 1165 1176 N/A INTRINSIC
low complexity region 1389 1396 N/A INTRINSIC
low complexity region 1577 1586 N/A INTRINSIC
coiled coil region 1628 1656 N/A INTRINSIC
Pfam:Cohesin_HEAT 1788 1829 1.1e-14 PFAM
Pfam:Nipped-B_C 2269 2450 2.8e-68 PFAM
low complexity region 2477 2501 N/A INTRINSIC
low complexity region 2502 2512 N/A INTRINSIC
low complexity region 2538 2550 N/A INTRINSIC
low complexity region 2626 2632 N/A INTRINSIC
low complexity region 2660 2684 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the homolog of the Drosophila melanogaster Nipped-B gene product and fungal Scc2-type sister chromatid cohesion proteins. The Drosophila protein facilitates enhancer-promoter communication of remote enhancers and plays a role in developmental regulation. It is also homologous to a family of chromosomal adherins with broad roles in sister chromatid cohesion, chromosome condensation, and DNA repair. The human protein has a bipartite nuclear targeting sequence and a putative HEAT repeat. Condensins, cohesins and other complexes with chromosome-related functions also contain HEAT repeats. Mutations in this gene result in Cornelia de Lange syndrome, a disorder characterized by dysmorphic facial features, growth delay, limb reduction defects, and mental retardation. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Nullizygous mice are embryonic lethal. Heterozygous null mice are growth-retarded and show various skeletal anomalies. Heterozygotes for a gene-trap allele are small and show craniofacial, heart, eye, hearing and behavioral defects, delayed bone maturation, reduced body fat, and postnatal mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
5730559C18Rik C T 1: 136,221,071 probably null Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Adcy5 A G 16: 35,303,710 Y1253C probably damaging Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Adm A G 7: 110,628,354 T26A probably benign Het
Ahnak T G 19: 9,003,305 V651G probably damaging Het
Akr7a5 G A 4: 139,318,221 V358I probably benign Het
Ankar T G 1: 72,643,258 T1383P probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cacna1h G A 17: 25,383,079 R1596C probably damaging Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Cfap54 T C 10: 93,066,846 Y148C probably damaging Het
Coa5 A G 1: 37,428,347 S60P probably damaging Het
Col6a2 T C 10: 76,611,049 N342D probably damaging Het
Cyp2c29 T G 19: 39,330,261 I434S possibly damaging Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dusp16 C A 6: 134,720,493 probably null Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Epn1 G A 7: 5,090,123 A145T probably damaging Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Gm6358 T C 16: 89,141,082 S70P unknown Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hsfy2 T A 1: 56,637,192 H62L probably benign Het
Ighm T C 12: 113,421,567 I258V unknown Het
Igkv13-71-1 G T 6: 69,235,799 noncoding transcript Het
Irx1 A C 13: 71,959,668 S298R probably damaging Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kcnc1 G A 7: 46,435,316 A555T probably benign Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lipo1 T C 19: 33,780,337 D244G probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Macf1 A T 4: 123,432,875 I4943N probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Olfr209 T C 16: 59,361,406 K271E probably benign Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pbx1 T C 1: 168,183,615 D372G possibly damaging Het
Pikfyve T A 1: 65,262,953 S1668T probably damaging Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Plag1 G T 4: 3,904,499 H231N probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Ptpn23 A T 9: 110,393,826 N54K probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rassf9 T A 10: 102,545,753 I332N probably damaging Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rnf214 A G 9: 45,867,821 S389P probably benign Het
Rxfp1 A C 3: 79,667,848 L181R probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Sh3bp4 C A 1: 89,145,489 S686R probably damaging Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stard13 A T 5: 151,062,673 S339R probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tinag T A 9: 76,996,935 E402V possibly damaging Het
Tmem183a T C 1: 134,361,611 D27G probably damaging Het
Tnfrsf13c T C 15: 82,223,902 T56A probably damaging Het
Tnrc18 A C 5: 142,733,576 L1985R unknown Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Ufl1 G T 4: 25,270,572 Q215K probably benign Het
Unkl T C 17: 25,231,865 *232R probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Xkr4 T C 1: 3,216,570 T466A probably benign Het
Zfp451 T A 1: 33,769,817 K988* probably null Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Nipbl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Nipbl APN 15 8366673 missense probably damaging 0.98
IGL00712:Nipbl APN 15 8369474 missense probably damaging 0.97
IGL00789:Nipbl APN 15 8296869 missense probably damaging 1.00
IGL01025:Nipbl APN 15 8350455 missense possibly damaging 0.46
IGL01087:Nipbl APN 15 8350497 missense possibly damaging 0.67
IGL01474:Nipbl APN 15 8311209 missense possibly damaging 0.63
IGL01537:Nipbl APN 15 8350539 missense probably benign
IGL01723:Nipbl APN 15 8335071 missense possibly damaging 0.71
IGL01749:Nipbl APN 15 8361821 missense probably benign 0.13
IGL02398:Nipbl APN 15 8327090 missense probably damaging 1.00
IGL02437:Nipbl APN 15 8359074 missense probably damaging 1.00
IGL02450:Nipbl APN 15 8343574 missense probably damaging 0.99
IGL02477:Nipbl APN 15 8323647 splice site probably null
IGL02547:Nipbl APN 15 8351598 missense probably benign
IGL02678:Nipbl APN 15 8351110 missense possibly damaging 0.92
IGL02679:Nipbl APN 15 8295553 missense probably benign 0.34
IGL03003:Nipbl APN 15 8350314 missense probably damaging 1.00
IGL03117:Nipbl APN 15 8332452 missense probably damaging 1.00
IGL03162:Nipbl APN 15 8338979 missense probably benign 0.37
IGL03224:Nipbl APN 15 8293085 missense probably damaging 0.98
IGL03339:Nipbl APN 15 8350876 missense probably benign 0.12
R0346_Nipbl_297 UTSW 15 8360956 missense probably damaging 0.99
R0347_Nipbl_476 UTSW 15 8350732 missense probably benign
R3620_nipbl_616 UTSW 15 8333024 missense probably damaging 0.99
R6388_Nipbl_651 UTSW 15 8300784 missense probably damaging 0.99
R8441_Nipbl_224 UTSW 15 8293115 missense probably benign 0.00
R0271:Nipbl UTSW 15 8361737 missense possibly damaging 0.76
R0346:Nipbl UTSW 15 8360956 missense probably damaging 0.99
R0347:Nipbl UTSW 15 8350732 missense probably benign
R0422:Nipbl UTSW 15 8351628 missense probably benign
R0486:Nipbl UTSW 15 8338870 splice site probably benign
R0652:Nipbl UTSW 15 8303480 missense probably benign 0.23
R0667:Nipbl UTSW 15 8361004 missense possibly damaging 0.86
R0689:Nipbl UTSW 15 8293078 splice site probably null
R0726:Nipbl UTSW 15 8351555 missense probably benign
R0881:Nipbl UTSW 15 8307612 missense probably damaging 0.98
R0904:Nipbl UTSW 15 8361718 missense probably benign
R0969:Nipbl UTSW 15 8292228 missense probably damaging 1.00
R1401:Nipbl UTSW 15 8372173 missense probably damaging 0.97
R1479:Nipbl UTSW 15 8350289 missense probably benign 0.00
R1495:Nipbl UTSW 15 8351280 missense probably benign 0.00
R1609:Nipbl UTSW 15 8366664 missense probably damaging 1.00
R1679:Nipbl UTSW 15 8302912 missense probably benign 0.31
R1756:Nipbl UTSW 15 8338551 missense possibly damaging 0.91
R1778:Nipbl UTSW 15 8319488 missense probably damaging 1.00
R1835:Nipbl UTSW 15 8343517 missense possibly damaging 0.80
R1883:Nipbl UTSW 15 8327132 missense probably damaging 1.00
R1914:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R1915:Nipbl UTSW 15 8343630 missense possibly damaging 0.93
R2030:Nipbl UTSW 15 8350287 missense probably damaging 1.00
R2046:Nipbl UTSW 15 8324467 missense probably benign 0.08
R2076:Nipbl UTSW 15 8311207 missense probably benign 0.11
R2163:Nipbl UTSW 15 8336919 missense probably damaging 0.99
R2170:Nipbl UTSW 15 8293218 missense probably damaging 1.00
R2425:Nipbl UTSW 15 8351482 missense probably benign 0.06
R2475:Nipbl UTSW 15 8335006 missense probably benign 0.05
R2484:Nipbl UTSW 15 8323698 missense probably damaging 0.99
R2970:Nipbl UTSW 15 8311239 missense probably damaging 1.00
R3116:Nipbl UTSW 15 8343592 missense probably benign 0.00
R3620:Nipbl UTSW 15 8333024 missense probably damaging 0.99
R3725:Nipbl UTSW 15 8295661 missense probably damaging 0.97
R3745:Nipbl UTSW 15 8358874 missense probably benign
R3902:Nipbl UTSW 15 8350246 missense possibly damaging 0.94
R3960:Nipbl UTSW 15 8350534 missense probably benign
R4164:Nipbl UTSW 15 8338934 missense probably benign 0.24
R4246:Nipbl UTSW 15 8332432 missense probably damaging 1.00
R4381:Nipbl UTSW 15 8359206 missense probably benign 0.00
R4394:Nipbl UTSW 15 8361861 missense probably benign 0.00
R4439:Nipbl UTSW 15 8338724 missense probably damaging 0.98
R4440:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4441:Nipbl UTSW 15 8366658 missense probably damaging 0.98
R4672:Nipbl UTSW 15 8302984 missense probably damaging 1.00
R4749:Nipbl UTSW 15 8365829 missense possibly damaging 0.95
R5300:Nipbl UTSW 15 8351497 missense probably benign
R5428:Nipbl UTSW 15 8330296 missense probably benign 0.00
R5641:Nipbl UTSW 15 8366712 missense possibly damaging 0.93
R5643:Nipbl UTSW 15 8358907 missense probably benign
R5644:Nipbl UTSW 15 8358907 missense probably benign
R5681:Nipbl UTSW 15 8301382 missense probably benign 0.22
R5741:Nipbl UTSW 15 8324649 missense possibly damaging 0.47
R5899:Nipbl UTSW 15 8334844 splice site probably null
R5970:Nipbl UTSW 15 8296818 missense probably benign 0.27
R6041:Nipbl UTSW 15 8324264 missense probably damaging 1.00
R6059:Nipbl UTSW 15 8295568 missense probably damaging 1.00
R6213:Nipbl UTSW 15 8334906 missense probably damaging 1.00
R6216:Nipbl UTSW 15 8318383 missense probably damaging 0.99
R6236:Nipbl UTSW 15 8324580 missense possibly damaging 0.88
R6267:Nipbl UTSW 15 8300895 missense possibly damaging 0.46
R6388:Nipbl UTSW 15 8300784 missense probably damaging 0.99
R6427:Nipbl UTSW 15 8351565 missense probably benign
R6707:Nipbl UTSW 15 8324559 missense probably benign 0.01
R6731:Nipbl UTSW 15 8322590 missense probably damaging 1.00
R6921:Nipbl UTSW 15 8303485 missense probably benign 0.28
R7239:Nipbl UTSW 15 8292135 critical splice donor site probably null
R7346:Nipbl UTSW 15 8343606 missense possibly damaging 0.94
R7485:Nipbl UTSW 15 8330295 missense probably benign 0.01
R7486:Nipbl UTSW 15 8295636 missense probably benign 0.25
R7598:Nipbl UTSW 15 8343493 missense probably benign 0.24
R7609:Nipbl UTSW 15 8305872 missense probably benign 0.27
R7674:Nipbl UTSW 15 8293101 missense probably benign 0.15
R7706:Nipbl UTSW 15 8351526 missense probably benign 0.01
R7760:Nipbl UTSW 15 8358702 missense probably damaging 1.00
R7766:Nipbl UTSW 15 8296849 missense probably benign 0.45
R7825:Nipbl UTSW 15 8291487 missense probably damaging 1.00
R7862:Nipbl UTSW 15 8325752 missense probably benign 0.06
R7958:Nipbl UTSW 15 8311258 missense possibly damaging 0.91
R8077:Nipbl UTSW 15 8311250 missense possibly damaging 0.49
R8119:Nipbl UTSW 15 8359212 missense probably benign 0.22
R8355:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8441:Nipbl UTSW 15 8293115 missense probably benign 0.00
R8455:Nipbl UTSW 15 8335044 missense probably damaging 0.98
R8717:Nipbl UTSW 15 8338741 missense probably benign
R8739:Nipbl UTSW 15 8303420 missense probably benign 0.08
R8854:Nipbl UTSW 15 8300726 missense probably damaging 1.00
R8887:Nipbl UTSW 15 8361787 missense probably damaging 1.00
R8942:Nipbl UTSW 15 8351620 missense probably benign
R8991:Nipbl UTSW 15 8291513 missense probably damaging 1.00
R9008:Nipbl UTSW 15 8327124 missense probably damaging 1.00
R9070:Nipbl UTSW 15 8338731 missense possibly damaging 0.82
R9116:Nipbl UTSW 15 8350856 missense probably benign 0.00
R9622:Nipbl UTSW 15 8336889 missense probably benign 0.27
R9778:Nipbl UTSW 15 8291548 missense probably benign 0.10
RF020:Nipbl UTSW 15 8358934 missense probably damaging 0.98
X0022:Nipbl UTSW 15 8351715 missense probably benign 0.05
X0027:Nipbl UTSW 15 8323537 missense probably damaging 1.00
Z1088:Nipbl UTSW 15 8307882 missense probably damaging 1.00
Z1176:Nipbl UTSW 15 8338699 missense possibly damaging 0.88
Z1177:Nipbl UTSW 15 8336952 missense probably damaging 1.00
Z1177:Nipbl UTSW 15 8338680 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCTGTGTCATCAAAGAGGTTG -3'
(R):5'- CTGTAACCTTGGTTAGCAGTAAC -3'

Sequencing Primer
(F):5'- TTGAGTAAAGAAATAAGAAAGGCGC -3'
(R):5'- ACCTTGGTTAGCAGTAACTTGTAG -3'
Posted On 2018-04-02