Incidental Mutation 'R6296:Olfr209'
ID508803
Institutional Source Beutler Lab
Gene Symbol Olfr209
Ensembl Gene ENSMUSG00000095706
Gene Nameolfactory receptor 209
SynonymsMOR182-6, GA_x54KRFPKG5P-55590495-55589578
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.218) question?
Stock #R6296 (G1)
Quality Score225.009
Status Not validated
Chromosome16
Chromosomal Location59361160-59363993 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59361406 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 271 (K271E)
Ref Sequence ENSEMBL: ENSMUSP00000147068 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055868] [ENSMUST00000208246] [ENSMUST00000208875] [ENSMUST00000213779]
Predicted Effect probably benign
Transcript: ENSMUST00000055868
AA Change: K271E

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000053192
Gene: ENSMUSG00000095706
AA Change: K271E

DomainStartEndE-ValueType
Pfam:7tm_4 30 304 1.3e-49 PFAM
Pfam:7TM_GPCR_Srsx 34 303 1.3e-6 PFAM
Pfam:7tm_1 40 289 6.2e-22 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000208246
Predicted Effect probably benign
Transcript: ENSMUST00000208875
AA Change: K271E

PolyPhen 2 Score 0.058 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect probably benign
Transcript: ENSMUST00000213779
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.6%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 82 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik T C 13: 59,742,683 D441G probably benign Het
4933427D14Rik T C 11: 72,195,754 K277R probably damaging Het
5730559C18Rik C T 1: 136,221,071 probably null Het
Aatf T C 11: 84,473,100 Y267C probably benign Het
Adcy5 A G 16: 35,303,710 Y1253C probably damaging Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Adm A G 7: 110,628,354 T26A probably benign Het
Ahnak T G 19: 9,003,305 V651G probably damaging Het
Akr7a5 G A 4: 139,318,221 V358I probably benign Het
Ankar T G 1: 72,643,258 T1383P probably damaging Het
Bpifb6 G C 2: 153,906,892 K269N possibly damaging Het
Cacna1c T C 6: 118,598,723 E1927G possibly damaging Het
Cacna1c T A 6: 118,652,714 T1249S probably benign Het
Cacna1h G A 17: 25,383,079 R1596C probably damaging Het
Cbll1 A G 12: 31,487,508 V415A probably benign Het
Cd300lf C T 11: 115,124,369 V132I probably benign Het
Cfap54 T C 10: 93,066,846 Y148C probably damaging Het
Coa5 A G 1: 37,428,347 S60P probably damaging Het
Col6a2 T C 10: 76,611,049 N342D probably damaging Het
Cyp2c29 T G 19: 39,330,261 I434S possibly damaging Het
Ddx11 G A 17: 66,150,729 probably null Het
Dgke C T 11: 89,040,749 V560I probably benign Het
Dusp16 C A 6: 134,720,493 probably null Het
Enpp4 G T 17: 44,102,480 N54K probably benign Het
Epn1 G A 7: 5,090,123 A145T probably damaging Het
Erc2 A T 14: 28,080,155 K764M probably damaging Het
Ercc6 G T 14: 32,526,403 E304* probably null Het
Fam117a T A 11: 95,364,145 C115S possibly damaging Het
Galntl5 T C 5: 25,186,165 S21P probably benign Het
Gm6358 T C 16: 89,141,082 S70P unknown Het
Grip1 C T 10: 120,075,464 Q696* probably null Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Hsfy2 T A 1: 56,637,192 H62L probably benign Het
Ighm T C 12: 113,421,567 I258V unknown Het
Igkv13-71-1 G T 6: 69,235,799 noncoding transcript Het
Irx1 A C 13: 71,959,668 S298R probably damaging Het
Jarid2 T A 13: 44,903,063 Y443N possibly damaging Het
Kcnc1 G A 7: 46,435,316 A555T probably benign Het
Krtap4-6 T A 11: 99,665,419 R161* probably null Het
Lipo1 T C 19: 33,780,337 D244G probably benign Het
Lmo2 T G 2: 103,970,601 V39G possibly damaging Het
Lrch2 C T X: 147,480,557 A369T probably damaging Homo
Macf1 A T 4: 123,432,875 I4943N probably damaging Het
Mkx A T 18: 7,000,591 probably null Het
Nek1 C T 8: 61,072,309 Q594* probably null Het
Nipbl T C 15: 8,300,895 M2349V possibly damaging Het
Nup155 T A 15: 8,153,155 C1201S probably damaging Het
Olfr1249 G A 2: 89,630,631 T89I probably damaging Het
Olfr1373 C A 11: 52,144,596 R311S probably benign Het
Osbpl1a A G 18: 12,819,503 probably null Het
Pbx1 T C 1: 168,183,615 D372G possibly damaging Het
Pikfyve T A 1: 65,262,953 S1668T probably damaging Het
Pitpnc1 T C 11: 107,226,266 H193R probably damaging Het
Plag1 G T 4: 3,904,499 H231N probably damaging Het
Prmt8 A G 6: 127,711,804 I201T probably damaging Het
Ptpn23 A T 9: 110,393,826 N54K probably damaging Het
Rab11fip4 T C 11: 79,690,829 probably null Het
Rassf9 T A 10: 102,545,753 I332N probably damaging Het
Rgs9 T C 11: 109,268,987 N173S probably benign Het
Rhbdl1 A G 17: 25,834,969 L309P probably damaging Het
Rnf214 A G 9: 45,867,821 S389P probably benign Het
Rxfp1 A C 3: 79,667,848 L181R probably damaging Het
Sfxn1 C T 13: 54,093,880 T208I probably benign Het
Sgo2b C T 8: 63,927,793 M668I probably benign Het
Sh3bp4 C A 1: 89,145,489 S686R probably damaging Het
Spata31d1d G A 13: 59,728,464 T419I possibly damaging Het
Spink5 T C 18: 44,014,757 S857P probably damaging Het
Stard13 A T 5: 151,062,673 S339R probably damaging Het
Stk35 T A 2: 129,810,888 Y436* probably null Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tinag T A 9: 76,996,935 E402V possibly damaging Het
Tmem183a T C 1: 134,361,611 D27G probably damaging Het
Tnfrsf13c T C 15: 82,223,902 T56A probably damaging Het
Tnrc18 A C 5: 142,733,576 L1985R unknown Het
Ttn G A 2: 76,749,329 T23740M probably damaging Het
Ufl1 G T 4: 25,270,572 Q215K probably benign Het
Unkl T C 17: 25,231,865 *232R probably null Het
Wnk4 A T 11: 101,273,998 N718Y probably damaging Het
Xkr4 T C 1: 3,216,570 T466A probably benign Het
Zfp451 T A 1: 33,769,817 K988* probably null Het
Zfp503 G C 14: 21,985,800 Y349* probably null Het
Zfp990 T A 4: 145,538,103 F557Y possibly damaging Het
Other mutations in Olfr209
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01083:Olfr209 APN 16 59361835 missense probably damaging 1.00
IGL01137:Olfr209 APN 16 59361972 missense probably benign 0.01
IGL01383:Olfr209 APN 16 59361953 missense probably benign 0.10
IGL01913:Olfr209 APN 16 59361931 missense probably damaging 1.00
IGL01914:Olfr209 APN 16 59361931 missense probably damaging 1.00
IGL02125:Olfr209 APN 16 59361516 missense probably benign
IGL02414:Olfr209 APN 16 59361714 missense probably damaging 1.00
IGL02512:Olfr209 APN 16 59361808 missense possibly damaging 0.95
PIT4495001:Olfr209 UTSW 16 59361508 missense probably damaging 0.99
R0029:Olfr209 UTSW 16 59361541 missense probably benign 0.00
R0531:Olfr209 UTSW 16 59361808 missense probably damaging 0.99
R1799:Olfr209 UTSW 16 59361880 missense probably benign 0.01
R1901:Olfr209 UTSW 16 59362163 missense probably benign 0.03
R1902:Olfr209 UTSW 16 59362163 missense probably benign 0.03
R1903:Olfr209 UTSW 16 59362163 missense probably benign 0.03
R1972:Olfr209 UTSW 16 59362113 missense probably damaging 0.96
R2471:Olfr209 UTSW 16 59361581 missense possibly damaging 0.79
R5013:Olfr209 UTSW 16 59361704 missense probably damaging 1.00
R5160:Olfr209 UTSW 16 59361766 missense probably damaging 1.00
R5883:Olfr209 UTSW 16 59361715 missense probably damaging 1.00
R6272:Olfr209 UTSW 16 59361585 missense possibly damaging 0.76
R6741:Olfr209 UTSW 16 59361555 missense probably damaging 1.00
R6928:Olfr209 UTSW 16 59361463 missense probably damaging 1.00
R7982:Olfr209 UTSW 16 59361564 missense probably benign
R8254:Olfr209 UTSW 16 59362171 missense probably benign 0.00
R8429:Olfr209 UTSW 16 59361627 missense possibly damaging 0.89
X0017:Olfr209 UTSW 16 59361639 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGGCCAAAATGTTATGATGCAC -3'
(R):5'- ATGTACTGGTAGCTTTCATTATGGC -3'

Sequencing Primer
(F):5'- TGCACTTAGAAAGAGAGTATCTGGTG -3'
(R):5'- TGGCTATTTTAATACAAGTGAGTACC -3'
Posted On2018-04-02