Incidental Mutation 'R6297:Xrn2'
ID508823
Institutional Source Beutler Lab
Gene Symbol Xrn2
Ensembl Gene ENSMUSG00000027433
Gene Name5'-3' exoribonuclease 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.962) question?
Stock #R6297 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location147012996-147078000 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 147026570 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 181 (R181H)
Ref Sequence ENSEMBL: ENSMUSP00000028921 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028921]
Predicted Effect probably damaging
Transcript: ENSMUST00000028921
AA Change: R181H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028921
Gene: ENSMUSG00000027433
AA Change: R181H

DomainStartEndE-ValueType
Pfam:XRN_N 1 254 1.5e-104 PFAM
ZnF_C2HC 262 278 7.99e-1 SMART
low complexity region 415 427 N/A INTRINSIC
PDB:3FQD|A 469 785 8e-75 PDB
low complexity region 913 932 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147057
Meta Mutation Damage Score 0.2409 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 5'-3' exonuclease that promotes transcription termination at cotranscriptional cleavage sites. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,132,530 V1205A probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Ate1 A G 7: 130,503,840 V316A probably damaging Het
Bpifa1 A G 2: 154,144,260 I102V probably benign Het
Catsperb A G 12: 101,591,396 probably null Het
Ccdc47 T C 11: 106,203,601 Y324C probably damaging Het
Cdh22 T C 2: 165,143,644 K341E possibly damaging Het
Cenpb A G 2: 131,178,369 probably benign Het
Dgkd A G 1: 87,926,144 I570V possibly damaging Het
Dhx32 A T 7: 133,742,800 Y27N probably damaging Het
Dnah10 A G 5: 124,775,080 D1824G possibly damaging Het
E130309D02Rik A T 5: 143,308,032 L230Q possibly damaging Het
Fbxo8 T A 8: 56,569,288 C112S probably damaging Het
Fndc3a T C 14: 72,563,540 D590G probably damaging Het
Gm19965 T A 1: 116,822,680 I697N possibly damaging Het
Gm35911 A G 5: 99,941,233 Y119C probably damaging Het
Greb1l G A 18: 10,469,494 D170N probably damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Igfn1 A T 1: 135,964,661 probably null Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Lman2 T C 13: 55,348,431 N267S probably damaging Het
Lrfn5 A T 12: 61,843,562 I546F probably benign Het
Lrrc4c T C 2: 97,629,619 S197P probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mdga2 A G 12: 66,506,253 Y793H probably damaging Het
Mdn1 C T 4: 32,730,054 R2799* probably null Het
Mup13 T A 4: 61,225,635 I148F probably benign Het
Olfr1023 A G 2: 85,886,815 N5S probably benign Het
Olfr170 A C 16: 19,605,930 V246G possibly damaging Het
Olfr968 A T 9: 39,772,226 D191E possibly damaging Het
Pdgfra A G 5: 75,173,474 K403E possibly damaging Het
Pigz A T 16: 31,944,937 Y271F probably damaging Het
Plekhg4 T C 8: 105,377,840 L517P probably damaging Het
Rnf20 T C 4: 49,642,132 L232P probably damaging Het
Rpa3 C A 6: 8,256,767 G71* probably null Het
Rsf1 GCG GCGACGGCGTCG 7: 97,579,907 probably benign Het
Rubcnl A G 14: 75,050,144 T623A probably benign Het
Sltm A G 9: 70,581,359 D597G probably damaging Het
Stpg2 T C 3: 139,701,671 V528A possibly damaging Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tas1r2 T A 4: 139,662,050 M419K possibly damaging Het
Txndc16 T C 14: 45,151,786 T486A probably benign Het
Vmn1r185 A G 7: 26,611,621 V153A probably benign Het
Vmn2r48 T C 7: 9,934,880 N548D probably damaging Het
Washc5 A G 15: 59,344,046 I378T possibly damaging Het
Wdr37 A G 13: 8,842,728 probably null Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Other mutations in Xrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Xrn2 APN 2 147036750 missense probably benign 0.00
IGL00950:Xrn2 APN 2 147028146 nonsense probably null
IGL01323:Xrn2 APN 2 147034847 splice site probably benign
IGL01328:Xrn2 APN 2 147029930 missense possibly damaging 0.90
IGL01545:Xrn2 APN 2 147038179 missense probably benign
IGL01729:Xrn2 APN 2 147036797 critical splice donor site probably null
IGL01805:Xrn2 APN 2 147028143 missense probably damaging 0.98
IGL02326:Xrn2 APN 2 147047713 missense probably benign 0.32
IGL02332:Xrn2 APN 2 147026590 missense probably damaging 1.00
IGL02556:Xrn2 APN 2 147038296 splice site probably benign
IGL02609:Xrn2 APN 2 147050025 missense probably benign 0.00
IGL02941:Xrn2 APN 2 147026524 missense probably damaging 1.00
IGL03119:Xrn2 APN 2 147042872 missense probably damaging 1.00
R0052:Xrn2 UTSW 2 147040965 splice site probably benign
R0114:Xrn2 UTSW 2 147029779 missense probably damaging 0.98
R0196:Xrn2 UTSW 2 147047660 missense probably damaging 0.99
R0799:Xrn2 UTSW 2 147029898 missense probably benign 0.03
R0991:Xrn2 UTSW 2 147042082 missense probably benign 0.40
R1444:Xrn2 UTSW 2 147061488 missense probably damaging 0.99
R1727:Xrn2 UTSW 2 147061516 missense probably benign 0.00
R1735:Xrn2 UTSW 2 147061423 missense probably damaging 1.00
R1885:Xrn2 UTSW 2 147049361 nonsense probably null
R2199:Xrn2 UTSW 2 147024750 missense probably damaging 0.96
R2884:Xrn2 UTSW 2 147047656 missense probably damaging 1.00
R3730:Xrn2 UTSW 2 147024809 missense probably benign 0.09
R3771:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3772:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3773:Xrn2 UTSW 2 147061287 missense probably benign 0.12
R3816:Xrn2 UTSW 2 147028200 missense probably damaging 1.00
R3927:Xrn2 UTSW 2 147038189 missense probably benign
R4173:Xrn2 UTSW 2 147047692 missense probably damaging 0.96
R4659:Xrn2 UTSW 2 147061474 missense probably benign 0.01
R4928:Xrn2 UTSW 2 147051718 missense possibly damaging 0.80
R5452:Xrn2 UTSW 2 147024713 critical splice acceptor site probably null
R5527:Xrn2 UTSW 2 147029755 missense probably benign 0.02
R6301:Xrn2 UTSW 2 147063342 missense probably benign 0.05
R6316:Xrn2 UTSW 2 147042010 missense probably damaging 1.00
R6705:Xrn2 UTSW 2 147036662 critical splice acceptor site probably null
R7173:Xrn2 UTSW 2 147042093 missense probably damaging 1.00
R7408:Xrn2 UTSW 2 147042097 critical splice donor site probably null
R7412:Xrn2 UTSW 2 147049346 missense probably damaging 0.99
R7501:Xrn2 UTSW 2 147029756 missense probably damaging 1.00
R7856:Xrn2 UTSW 2 147068473 splice site probably null
Z1177:Xrn2 UTSW 2 147028206 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AAACATTGCCTCTTTCGTCTAGGTG -3'
(R):5'- ATGCAAGGCAACCCATTTCC -3'

Sequencing Primer
(F):5'- AGGTGGCTTTCTTCCTCCAG -3'
(R):5'- CCATTTCCAATAACCTTGAAAGCTTC -3'
Posted On2018-04-02