Mutagenetix > Incidental Mutation

Incidental Mutation 'R6297:Rnf20'

508829

Institutional Source

Beutler Lab

Gene Symbol

Rnf20

Ensembl Gene

ENSMUSG00000028309

Gene Name

ring finger protein 20

Synonyms

4833430L21Rik

MMRRC Submission

044464-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6297 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

49632006-49656887 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 49642132 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Proline at position 232 (L232P)

Ref Sequence

ENSEMBL: ENSMUSP00000118293 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000029989] [ENSMUST00000140341] [ENSMUST00000146547] [ENSMUST00000156314] [ENSMUST00000167496]

AlphaFold

Q5DTM8

Predicted Effect

probably damaging
Transcript: ENSMUST00000029989
AA Change: L232P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000029989
Gene: ENSMUSG00000028309
AA Change: L232P

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000126675

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000132782

Predicted Effect

probably benign
Transcript: ENSMUST00000140341

SMART Domains

Protein: ENSMUSP00000121334
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000146547

SMART Domains

Protein: ENSMUSP00000120668
Gene: ENSMUSG00000028309

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149862

Predicted Effect

probably damaging
Transcript: ENSMUST00000156314
AA Change: L232P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000118293
Gene: ENSMUSG00000028309
AA Change: L232P

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
low complexity region	164	172	N/A	INTRINSIC
SCOP:d1gw5a_	174	294	3e-3	SMART
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	606	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000167496
AA Change: L232P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)

SMART Domains

Protein: ENSMUSP00000128546
Gene: ENSMUSG00000028309
AA Change: L232P

Domain	Start	End	E-Value	Type
coiled coil region	45	85	N/A	INTRINSIC
coiled coil region	172	200	N/A	INTRINSIC
coiled coil region	317	378	N/A	INTRINSIC
coiled coil region	429	514	N/A	INTRINSIC
coiled coil region	550	733	N/A	INTRINSIC
coiled coil region	769	805	N/A	INTRINSIC
coiled coil region	828	867	N/A	INTRINSIC
RING	920	958	2e-4	SMART

Meta Mutation Damage Score

0.8970

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.4%

Validation Efficiency

98% (45/46)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene shares similarity with BRE1 of S. cerevisiae. The protein encoded by this human gene is an E3 ubiquitin ligase that regulates chromosome structure by monoubiquitinating histone H2B. This protein acts as a putative tumor suppressor and positively regulates the p53 tumor suppressor as well as numerous histone H2A and H2B genes. In contrast, this protein also suppresses the expression of several protooncogenes and growth-related genes, including many genes that are induced by epidermal growth factor. This gene selectively suppresses the expression of some genes by interfering with chromatin recruitment of transcription elongation factor SII (TFIIS). [provided by RefSeq, Feb 2012]

Allele List at MGI

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Abca4	T	C	3: 122,132,530	V1205A	probably benign	Het
Adgra3	G	A	5: 49,960,847	P1120S	probably benign	Het
Ate1	A	G	7: 130,503,840	V316A	probably damaging	Het
Bpifa1	A	G	2: 154,144,260	I102V	probably benign	Het
Catsperb	A	G	12: 101,591,396		probably null	Het
Ccdc47	T	C	11: 106,203,601	Y324C	probably damaging	Het
Cdh22	T	C	2: 165,143,644	K341E	possibly damaging	Het
Cenpb	A	G	2: 131,178,369		probably benign	Het
Dgkd	A	G	1: 87,926,144	I570V	possibly damaging	Het
Dhx32	A	T	7: 133,742,800	Y27N	probably damaging	Het
Dnah10	A	G	5: 124,775,080	D1824G	possibly damaging	Het
E130309D02Rik	A	T	5: 143,308,032	L230Q	possibly damaging	Het
Fbxo8	T	A	8: 56,569,288	C112S	probably damaging	Het
Fndc3a	T	C	14: 72,563,540	D590G	probably damaging	Het
Gm19965	T	A	1: 116,822,680	I697N	possibly damaging	Het
Gm35911	A	G	5: 99,941,233	Y119C	probably damaging	Het
Greb1l	G	A	18: 10,469,494	D170N	probably damaging	Het
Haus5	C	T	7: 30,658,976	W298*	probably null	Het
Igfn1	A	T	1: 135,964,661		probably null	Het
Ighg2b	T	C	12: 113,306,892	E206G	unknown	Het
Lman2	T	C	13: 55,348,431	N267S	probably damaging	Het
Lrfn5	A	T	12: 61,843,562	I546F	probably benign	Het
Lrrc4c	T	C	2: 97,629,619	S197P	probably damaging	Het
Mbtd1	C	T	11: 93,932,232	H493Y	possibly damaging	Het
Mdga2	A	G	12: 66,506,253	Y793H	probably damaging	Het
Mdn1	C	T	4: 32,730,054	R2799*	probably null	Het
Mup13	T	A	4: 61,225,635	I148F	probably benign	Het
Olfr1023	A	G	2: 85,886,815	N5S	probably benign	Het
Olfr170	A	C	16: 19,605,930	V246G	possibly damaging	Het
Olfr968	A	T	9: 39,772,226	D191E	possibly damaging	Het
Pdgfra	A	G	5: 75,173,474	K403E	possibly damaging	Het
Pigz	A	T	16: 31,944,937	Y271F	probably damaging	Het
Plekhg4	T	C	8: 105,377,840	L517P	probably damaging	Het
Rpa3	C	A	6: 8,256,767	G71*	probably null	Het
Rsf1	GCG	GCGACGGCGTCG	7: 97,579,907		probably benign	Het
Rubcnl	A	G	14: 75,050,144	T623A	probably benign	Het
Sltm	A	G	9: 70,581,359	D597G	probably damaging	Het
Stpg2	T	C	3: 139,701,671	V528A	possibly damaging	Het
Supt6	C	T	11: 78,226,059	R589Q	possibly damaging	Het
Tas1r2	T	A	4: 139,662,050	M419K	possibly damaging	Het
Txndc16	T	C	14: 45,151,786	T486A	probably benign	Het
Vmn1r185	A	G	7: 26,611,621	V153A	probably benign	Het
Vmn2r48	T	C	7: 9,934,880	N548D	probably damaging	Het
Washc5	A	G	15: 59,344,046	I378T	possibly damaging	Het
Wdr37	A	G	13: 8,842,728		probably null	Het
Xrn2	G	A	2: 147,026,570	R181H	probably damaging	Het
Ylpm1	C	G	12: 85,015,277	P651A	unknown	Het

Other mutations in Rnf20

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00467:Rnf20	APN	4	49655480	nonsense	probably null
IGL01319:Rnf20	APN	4	49649326	missense	probably damaging	0.99
IGL01666:Rnf20	APN	4	49654486	nonsense	probably null
IGL01975:Rnf20	APN	4	49654473	missense	probably benign	0.00
IGL02130:Rnf20	APN	4	49644481	splice site	probably benign
IGL02179:Rnf20	APN	4	49638712	missense	probably benign	0.04
IGL03096:Rnf20	APN	4	49638615	splice site	probably benign
IGL03120:Rnf20	APN	4	49649955	splice site	probably benign
IGL03208:Rnf20	APN	4	49645706	splice site	probably benign
IGL03257:Rnf20	APN	4	49645687	missense	probably benign	0.19
IGL03349:Rnf20	APN	4	49655936	missense	probably damaging	1.00
R0372:Rnf20	UTSW	4	49650176	missense	possibly damaging	0.53
R0486:Rnf20	UTSW	4	49645907	missense	possibly damaging	0.57
R0791:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R0927:Rnf20	UTSW	4	49642176	missense	probably damaging	1.00
R1256:Rnf20	UTSW	4	49638230	missense	probably benign	0.33
R1272:Rnf20	UTSW	4	49651496	missense	probably damaging	0.99
R1460:Rnf20	UTSW	4	49645873	splice site	probably benign
R1522:Rnf20	UTSW	4	49638197	missense	possibly damaging	0.92
R1698:Rnf20	UTSW	4	49651498	nonsense	probably null
R1848:Rnf20	UTSW	4	49644628	missense	probably damaging	1.00
R2214:Rnf20	UTSW	4	49648344	missense	possibly damaging	0.77
R2497:Rnf20	UTSW	4	49652676	splice site	probably null
R2915:Rnf20	UTSW	4	49638769	missense	probably benign	0.13
R4726:Rnf20	UTSW	4	49654579	nonsense	probably null
R4770:Rnf20	UTSW	4	49633412	critical splice donor site	probably null
R4799:Rnf20	UTSW	4	49649962	critical splice acceptor site	probably null
R4960:Rnf20	UTSW	4	49638029	missense	probably damaging	0.99
R5022:Rnf20	UTSW	4	49642016	intron	probably benign
R5146:Rnf20	UTSW	4	49651456	missense	probably benign	0.21
R5379:Rnf20	UTSW	4	49652639	missense	possibly damaging	0.47
R5423:Rnf20	UTSW	4	49644620	missense	probably damaging	0.99
R6608:Rnf20	UTSW	4	49650051	missense	probably benign	0.05
R7064:Rnf20	UTSW	4	49644580	nonsense	probably null
R7776:Rnf20	UTSW	4	49644592	nonsense	probably null
R8735:Rnf20	UTSW	4	49655964	missense	possibly damaging	0.95
R8995:Rnf20	UTSW	4	49648437	missense	possibly damaging	0.94
R9599:Rnf20	UTSW	4	49638751	missense	probably benign	0.00
R9661:Rnf20	UTSW	4	49654556	missense	probably damaging	0.99
Z1177:Rnf20	UTSW	4	49645655	missense	probably damaging	0.98

Predicted Primers

PCR Primer
(F):5'- AGGTTACTTTCTGACATTCTGAGG -3'
(R):5'- TCATGGACGTTGCTCTCTCAG -3'

Sequencing Primer
(F):5'- ACTTTCTGACATTCTGAGGATAGTG -3'
(R):5'- GACGTTGCTCTCTCAGAGTTGAC -3'

Posted On

2018-04-02