Incidental Mutation 'R6297:Sltm'
ID508847
Institutional Source Beutler Lab
Gene Symbol Sltm
Ensembl Gene ENSMUSG00000032212
Gene NameSAFB-like, transcription modulator
Synonyms9130215G10Rik, 5730555F13Rik, 5730455C01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.964) question?
Stock #R6297 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location70542754-70592234 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 70581359 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 597 (D597G)
Ref Sequence ENSEMBL: ENSMUSP00000150324 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049263] [ENSMUST00000213808] [ENSMUST00000216816] [ENSMUST00000217593]
Predicted Effect unknown
Transcript: ENSMUST00000049263
AA Change: D597G
SMART Domains Protein: ENSMUSP00000049112
Gene: ENSMUSG00000032212
AA Change: D597G

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
SAP 22 56 2.49e-10 SMART
low complexity region 74 86 N/A INTRINSIC
coiled coil region 152 180 N/A INTRINSIC
low complexity region 318 330 N/A INTRINSIC
low complexity region 352 384 N/A INTRINSIC
RRM 385 458 2.06e-16 SMART
low complexity region 498 526 N/A INTRINSIC
low complexity region 536 552 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
coiled coil region 635 727 N/A INTRINSIC
low complexity region 824 853 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1015 1028 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000213808
Predicted Effect noncoding transcript
Transcript: ENSMUST00000214834
Predicted Effect unknown
Transcript: ENSMUST00000216816
AA Change: D579G
Predicted Effect noncoding transcript
Transcript: ENSMUST00000216881
Predicted Effect probably damaging
Transcript: ENSMUST00000217593
AA Change: D597G

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,132,530 V1205A probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Ate1 A G 7: 130,503,840 V316A probably damaging Het
Bpifa1 A G 2: 154,144,260 I102V probably benign Het
Catsperb A G 12: 101,591,396 probably null Het
Ccdc47 T C 11: 106,203,601 Y324C probably damaging Het
Cdh22 T C 2: 165,143,644 K341E possibly damaging Het
Cenpb A G 2: 131,178,369 probably benign Het
Dgkd A G 1: 87,926,144 I570V possibly damaging Het
Dhx32 A T 7: 133,742,800 Y27N probably damaging Het
Dnah10 A G 5: 124,775,080 D1824G possibly damaging Het
E130309D02Rik A T 5: 143,308,032 L230Q possibly damaging Het
Fbxo8 T A 8: 56,569,288 C112S probably damaging Het
Fndc3a T C 14: 72,563,540 D590G probably damaging Het
Gm19965 T A 1: 116,822,680 I697N possibly damaging Het
Gm35911 A G 5: 99,941,233 Y119C probably damaging Het
Greb1l G A 18: 10,469,494 D170N probably damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Igfn1 A T 1: 135,964,661 probably null Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Lman2 T C 13: 55,348,431 N267S probably damaging Het
Lrfn5 A T 12: 61,843,562 I546F probably benign Het
Lrrc4c T C 2: 97,629,619 S197P probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mdga2 A G 12: 66,506,253 Y793H probably damaging Het
Mdn1 C T 4: 32,730,054 R2799* probably null Het
Mup13 T A 4: 61,225,635 I148F probably benign Het
Olfr1023 A G 2: 85,886,815 N5S probably benign Het
Olfr170 A C 16: 19,605,930 V246G possibly damaging Het
Olfr968 A T 9: 39,772,226 D191E possibly damaging Het
Pdgfra A G 5: 75,173,474 K403E possibly damaging Het
Pigz A T 16: 31,944,937 Y271F probably damaging Het
Plekhg4 T C 8: 105,377,840 L517P probably damaging Het
Rnf20 T C 4: 49,642,132 L232P probably damaging Het
Rpa3 C A 6: 8,256,767 G71* probably null Het
Rsf1 GCG GCGACGGCGTCG 7: 97,579,907 probably benign Het
Rubcnl A G 14: 75,050,144 T623A probably benign Het
Stpg2 T C 3: 139,701,671 V528A possibly damaging Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tas1r2 T A 4: 139,662,050 M419K possibly damaging Het
Txndc16 T C 14: 45,151,786 T486A probably benign Het
Vmn1r185 A G 7: 26,611,621 V153A probably benign Het
Vmn2r48 T C 7: 9,934,880 N548D probably damaging Het
Washc5 A G 15: 59,344,046 I378T possibly damaging Het
Wdr37 A G 13: 8,842,728 probably null Het
Xrn2 G A 2: 147,026,570 R181H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Other mutations in Sltm
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00577:Sltm APN 9 70579342 missense probably damaging 1.00
IGL01755:Sltm APN 9 70583922 splice site probably null
IGL01782:Sltm APN 9 70573641 missense probably damaging 1.00
IGL02441:Sltm APN 9 70587185 missense probably damaging 1.00
IGL02831:Sltm APN 9 70584865 missense probably damaging 1.00
IGL02947:Sltm APN 9 70591664 missense probably benign 0.05
IGL03166:Sltm APN 9 70542969 missense possibly damaging 0.87
R0288:Sltm UTSW 9 70579351 missense probably damaging 1.00
R0555:Sltm UTSW 9 70586081 missense probably damaging 1.00
R0815:Sltm UTSW 9 70561908 missense probably benign 0.04
R0863:Sltm UTSW 9 70561908 missense probably benign 0.04
R1315:Sltm UTSW 9 70543065 missense probably benign 0.13
R1533:Sltm UTSW 9 70586666 missense probably damaging 1.00
R1676:Sltm UTSW 9 70573647 missense probably damaging 1.00
R1764:Sltm UTSW 9 70561800 missense probably benign 0.00
R1845:Sltm UTSW 9 70543032 missense possibly damaging 0.60
R2049:Sltm UTSW 9 70581301 missense probably benign 0.00
R2163:Sltm UTSW 9 70591682 missense probably damaging 0.99
R3410:Sltm UTSW 9 70585958 missense probably damaging 0.97
R4323:Sltm UTSW 9 70580247 missense probably benign
R4632:Sltm UTSW 9 70579369 missense possibly damaging 0.86
R4748:Sltm UTSW 9 70581365 missense probably damaging 1.00
R4756:Sltm UTSW 9 70591610 missense possibly damaging 0.57
R4782:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4799:Sltm UTSW 9 70589057 missense probably damaging 1.00
R4887:Sltm UTSW 9 70588978 missense probably damaging 1.00
R5221:Sltm UTSW 9 70579403 missense probably damaging 1.00
R5263:Sltm UTSW 9 70584799 missense unknown
R5982:Sltm UTSW 9 70586804 missense probably damaging 1.00
R6456:Sltm UTSW 9 70542987 missense probably damaging 1.00
R6658:Sltm UTSW 9 70581362 missense probably damaging 1.00
R6720:Sltm UTSW 9 70573710 missense probably damaging 1.00
R6770:Sltm UTSW 9 70584777 missense unknown
R6923:Sltm UTSW 9 70574610 missense probably damaging 1.00
R7051:Sltm UTSW 9 70559066 missense probably damaging 1.00
R7166:Sltm UTSW 9 70584850 missense probably damaging 1.00
R7257:Sltm UTSW 9 70543965 splice site probably null
R7400:Sltm UTSW 9 70586070 missense probably damaging 1.00
R7438:Sltm UTSW 9 70573466 missense unknown
R7484:Sltm UTSW 9 70573897 missense unknown
R7630:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7631:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7632:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7633:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7862:Sltm UTSW 9 70572164 nonsense probably null
R7885:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7886:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7888:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7889:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7891:Sltm UTSW 9 70586673 missense possibly damaging 0.94
R7915:Sltm UTSW 9 70587149 missense probably damaging 1.00
R8030:Sltm UTSW 9 70585979 nonsense probably null
R8062:Sltm UTSW 9 70573497 missense unknown
R8099:Sltm UTSW 9 70586078 missense probably damaging 1.00
R8374:Sltm UTSW 9 70561945 missense probably null
R8698:Sltm UTSW 9 70587070 missense probably benign 0.27
Predicted Primers PCR Primer
(F):5'- TCCAAAAGCTGTTGTCATCAAGC -3'
(R):5'- ATCCCTAGCAGGCTGGATTATAG -3'

Sequencing Primer
(F):5'- CTGCGTGCCAGAAAGTTCATG -3'
(R):5'- CCTAGCAGGCTGGATTATAGCTAAAG -3'
Posted On2018-04-02