Incidental Mutation 'R6297:Mbtd1'
ID508849
Institutional Source Beutler Lab
Gene Symbol Mbtd1
Ensembl Gene ENSMUSG00000059474
Gene Namembt domain containing 1
Synonymshemp
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6297 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location93885852-93946985 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 93932232 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Tyrosine at position 493 (H493Y)
Ref Sequence ENSEMBL: ENSMUSP00000103486 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063645] [ENSMUST00000063718] [ENSMUST00000107852] [ENSMUST00000107853] [ENSMUST00000107854]
Predicted Effect probably benign
Transcript: ENSMUST00000063645
SMART Domains Protein: ENSMUSP00000070248
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 7e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 3.11e-22 SMART
MBT 256 357 1.28e-41 SMART
MBT 361 459 1.61e-38 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000063718
AA Change: H515Y

PolyPhen 2 Score 0.736 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000065442
Gene: ENSMUSG00000059474
AA Change: H515Y

DomainStartEndE-ValueType
low complexity region 29 46 N/A INTRINSIC
PDB:2W0T|A 74 96 7e-6 PDB
low complexity region 97 112 N/A INTRINSIC
low complexity region 136 152 N/A INTRINSIC
MBT 166 270 3.11e-22 SMART
MBT 278 379 1.28e-41 SMART
MBT 383 481 1.61e-38 SMART
MBT 489 585 4.11e-54 SMART
low complexity region 586 614 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000107852
SMART Domains Protein: ENSMUSP00000103484
Gene: ENSMUSG00000059474

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 5e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 3.11e-22 SMART
MBT 256 357 1.28e-41 SMART
MBT 361 433 1.29e-4 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000107853
AA Change: H493Y

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103485
Gene: ENSMUSG00000059474
AA Change: H493Y

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.8e-44 SMART
MBT 361 459 6.1e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000107854
AA Change: H493Y

PolyPhen 2 Score 0.788 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000103486
Gene: ENSMUSG00000059474
AA Change: H493Y

DomainStartEndE-ValueType
low complexity region 7 24 N/A INTRINSIC
PDB:2W0T|A 52 74 1e-6 PDB
low complexity region 75 90 N/A INTRINSIC
low complexity region 114 130 N/A INTRINSIC
MBT 144 248 1.2e-24 SMART
MBT 256 357 4.9e-44 SMART
MBT 361 459 6.2e-41 SMART
MBT 467 563 1.6e-56 SMART
low complexity region 564 592 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150237
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155518
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155841
Meta Mutation Damage Score 0.1237 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (45/46)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality and severe abnormalities in hematopoietic stem cell function and skeletal formation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,132,530 V1205A probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Ate1 A G 7: 130,503,840 V316A probably damaging Het
Bpifa1 A G 2: 154,144,260 I102V probably benign Het
Catsperb A G 12: 101,591,396 probably null Het
Ccdc47 T C 11: 106,203,601 Y324C probably damaging Het
Cdh22 T C 2: 165,143,644 K341E possibly damaging Het
Cenpb A G 2: 131,178,369 probably benign Het
Dgkd A G 1: 87,926,144 I570V possibly damaging Het
Dhx32 A T 7: 133,742,800 Y27N probably damaging Het
Dnah10 A G 5: 124,775,080 D1824G possibly damaging Het
E130309D02Rik A T 5: 143,308,032 L230Q possibly damaging Het
Fbxo8 T A 8: 56,569,288 C112S probably damaging Het
Fndc3a T C 14: 72,563,540 D590G probably damaging Het
Gm19965 T A 1: 116,822,680 I697N possibly damaging Het
Gm35911 A G 5: 99,941,233 Y119C probably damaging Het
Greb1l G A 18: 10,469,494 D170N probably damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Igfn1 A T 1: 135,964,661 probably null Het
Ighg2b T C 12: 113,306,892 E206G unknown Het
Lman2 T C 13: 55,348,431 N267S probably damaging Het
Lrfn5 A T 12: 61,843,562 I546F probably benign Het
Lrrc4c T C 2: 97,629,619 S197P probably damaging Het
Mdga2 A G 12: 66,506,253 Y793H probably damaging Het
Mdn1 C T 4: 32,730,054 R2799* probably null Het
Mup13 T A 4: 61,225,635 I148F probably benign Het
Olfr1023 A G 2: 85,886,815 N5S probably benign Het
Olfr170 A C 16: 19,605,930 V246G possibly damaging Het
Olfr968 A T 9: 39,772,226 D191E possibly damaging Het
Pdgfra A G 5: 75,173,474 K403E possibly damaging Het
Pigz A T 16: 31,944,937 Y271F probably damaging Het
Plekhg4 T C 8: 105,377,840 L517P probably damaging Het
Rnf20 T C 4: 49,642,132 L232P probably damaging Het
Rpa3 C A 6: 8,256,767 G71* probably null Het
Rsf1 GCG GCGACGGCGTCG 7: 97,579,907 probably benign Het
Rubcnl A G 14: 75,050,144 T623A probably benign Het
Sltm A G 9: 70,581,359 D597G probably damaging Het
Stpg2 T C 3: 139,701,671 V528A possibly damaging Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tas1r2 T A 4: 139,662,050 M419K possibly damaging Het
Txndc16 T C 14: 45,151,786 T486A probably benign Het
Vmn1r185 A G 7: 26,611,621 V153A probably benign Het
Vmn2r48 T C 7: 9,934,880 N548D probably damaging Het
Washc5 A G 15: 59,344,046 I378T possibly damaging Het
Wdr37 A G 13: 8,842,728 probably null Het
Xrn2 G A 2: 147,026,570 R181H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Other mutations in Mbtd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00814:Mbtd1 APN 11 93943840 missense possibly damaging 0.94
IGL00819:Mbtd1 APN 11 93931811 critical splice acceptor site probably null
IGL01140:Mbtd1 APN 11 93924432 missense probably damaging 1.00
IGL01553:Mbtd1 APN 11 93923214 missense probably benign 0.35
IGL01893:Mbtd1 APN 11 93921412 missense probably null
IGL02218:Mbtd1 APN 11 93931803 splice site probably benign
IGL02406:Mbtd1 APN 11 93908858 missense probably damaging 1.00
IGL03002:Mbtd1 APN 11 93924490 missense probably benign 0.15
IGL03347:Mbtd1 APN 11 93923179 missense probably benign 0.01
R0027:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
R0027:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
R0311:Mbtd1 UTSW 11 93921357 splice site probably null
R0513:Mbtd1 UTSW 11 93932212 splice site probably null
R0646:Mbtd1 UTSW 11 93905212 missense probably damaging 1.00
R0734:Mbtd1 UTSW 11 93923146 missense probably damaging 1.00
R0835:Mbtd1 UTSW 11 93931839 missense probably benign 0.23
R1295:Mbtd1 UTSW 11 93910359 missense probably damaging 0.99
R1296:Mbtd1 UTSW 11 93910359 missense probably damaging 0.99
R1996:Mbtd1 UTSW 11 93932396 frame shift probably null
R2157:Mbtd1 UTSW 11 93910388 missense probably benign 0.20
R3977:Mbtd1 UTSW 11 93905175 missense probably benign
R4435:Mbtd1 UTSW 11 93932222 missense probably benign
R4589:Mbtd1 UTSW 11 93921419 missense probably damaging 1.00
R4647:Mbtd1 UTSW 11 93924611 missense probably damaging 1.00
R4824:Mbtd1 UTSW 11 93925702 missense probably benign 0.00
R4919:Mbtd1 UTSW 11 93923148 unclassified probably null
R5045:Mbtd1 UTSW 11 93931815 missense probably benign 0.26
R5095:Mbtd1 UTSW 11 93929671 missense probably damaging 1.00
R5227:Mbtd1 UTSW 11 93924648 missense possibly damaging 0.54
R5619:Mbtd1 UTSW 11 93929879 intron probably null
R6057:Mbtd1 UTSW 11 93929659 missense probably damaging 0.99
R6293:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6294:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6295:Mbtd1 UTSW 11 93932232 missense possibly damaging 0.79
R6998:Mbtd1 UTSW 11 93924612 missense probably damaging 1.00
R7423:Mbtd1 UTSW 11 93943796 missense probably benign 0.38
R7519:Mbtd1 UTSW 11 93908899 missense probably damaging 1.00
X0024:Mbtd1 UTSW 11 93924549 missense possibly damaging 0.85
Z1177:Mbtd1 UTSW 11 93912459 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGAATGGTAGCATGATCACGAC -3'
(R):5'- ATAGAGGTCAGGGGACTCAC -3'

Sequencing Primer
(F):5'- TGGTAGCATGATCACGACATAAG -3'
(R):5'- TCAGGGGACTCACAGTCTAC -3'
Posted On2018-04-02