Incidental Mutation 'R6297:Ighg2b'
ID508854
Institutional Source Beutler Lab
Gene Symbol Ighg2b
Ensembl Gene ENSMUSG00000076613
Gene Nameimmunoglobulin heavy constant gamma 2B
SynonymsIgG2b, gamma2b
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6297 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location113302965-113307933 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 113306892 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 206 (E206G)
Gene Model predicted gene model for transcript(s):
Predicted Effect unknown
Transcript: ENSMUST00000103418
AA Change: E206G
SMART Domains Protein: ENSMUSP00000100214
Gene: ENSMUSG00000076613
AA Change: E206G

DomainStartEndE-ValueType
IGc1 22 92 6.9e-16 SMART
low complexity region 108 121 N/A INTRINSIC
IG_like 145 220 4.02e-2 SMART
IGc1 251 324 1.64e-31 SMART
Predicted Effect unknown
Transcript: ENSMUST00000192188
AA Change: E206G
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (45/46)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 122,132,530 V1205A probably benign Het
Adgra3 G A 5: 49,960,847 P1120S probably benign Het
Ate1 A G 7: 130,503,840 V316A probably damaging Het
Bpifa1 A G 2: 154,144,260 I102V probably benign Het
Catsperb A G 12: 101,591,396 probably null Het
Ccdc47 T C 11: 106,203,601 Y324C probably damaging Het
Cdh22 T C 2: 165,143,644 K341E possibly damaging Het
Cenpb A G 2: 131,178,369 probably benign Het
Dgkd A G 1: 87,926,144 I570V possibly damaging Het
Dhx32 A T 7: 133,742,800 Y27N probably damaging Het
Dnah10 A G 5: 124,775,080 D1824G possibly damaging Het
E130309D02Rik A T 5: 143,308,032 L230Q possibly damaging Het
Fbxo8 T A 8: 56,569,288 C112S probably damaging Het
Fndc3a T C 14: 72,563,540 D590G probably damaging Het
Gm19965 T A 1: 116,822,680 I697N possibly damaging Het
Gm35911 A G 5: 99,941,233 Y119C probably damaging Het
Greb1l G A 18: 10,469,494 D170N probably damaging Het
Haus5 C T 7: 30,658,976 W298* probably null Het
Igfn1 A T 1: 135,964,661 probably null Het
Lman2 T C 13: 55,348,431 N267S probably damaging Het
Lrfn5 A T 12: 61,843,562 I546F probably benign Het
Lrrc4c T C 2: 97,629,619 S197P probably damaging Het
Mbtd1 C T 11: 93,932,232 H493Y possibly damaging Het
Mdga2 A G 12: 66,506,253 Y793H probably damaging Het
Mdn1 C T 4: 32,730,054 R2799* probably null Het
Mup13 T A 4: 61,225,635 I148F probably benign Het
Olfr1023 A G 2: 85,886,815 N5S probably benign Het
Olfr170 A C 16: 19,605,930 V246G possibly damaging Het
Olfr968 A T 9: 39,772,226 D191E possibly damaging Het
Pdgfra A G 5: 75,173,474 K403E possibly damaging Het
Pigz A T 16: 31,944,937 Y271F probably damaging Het
Plekhg4 T C 8: 105,377,840 L517P probably damaging Het
Rnf20 T C 4: 49,642,132 L232P probably damaging Het
Rpa3 C A 6: 8,256,767 G71* probably null Het
Rsf1 GCG GCGACGGCGTCG 7: 97,579,907 probably benign Het
Rubcnl A G 14: 75,050,144 T623A probably benign Het
Sltm A G 9: 70,581,359 D597G probably damaging Het
Stpg2 T C 3: 139,701,671 V528A possibly damaging Het
Supt6 C T 11: 78,226,059 R589Q possibly damaging Het
Tas1r2 T A 4: 139,662,050 M419K possibly damaging Het
Txndc16 T C 14: 45,151,786 T486A probably benign Het
Vmn1r185 A G 7: 26,611,621 V153A probably benign Het
Vmn2r48 T C 7: 9,934,880 N548D probably damaging Het
Washc5 A G 15: 59,344,046 I378T possibly damaging Het
Wdr37 A G 13: 8,842,728 probably null Het
Xrn2 G A 2: 147,026,570 R181H probably damaging Het
Ylpm1 C G 12: 85,015,277 P651A unknown Het
Other mutations in Ighg2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01366:Ighg2b APN 12 113307036 missense possibly damaging 0.79
IGL01837:Ighg2b APN 12 113306445 missense unknown
IGL01973:Ighg2b APN 12 113307685 missense unknown
IGL01998:Ighg2b APN 12 113307089 missense unknown
IGL02147:Ighg2b APN 12 113306391 makesense probably null
IGL02183:Ighg2b APN 12 113307829 missense unknown
IGL03089:Ighg2b APN 12 113306678 missense probably damaging 1.00
PIT4453001:Ighg2b UTSW 12 113306872 missense unknown
R4199:Ighg2b UTSW 12 113307287 missense probably damaging 0.96
R4459:Ighg2b UTSW 12 113306958 missense unknown
R4577:Ighg2b UTSW 12 113306892 missense unknown
R4589:Ighg2b UTSW 12 113306484 missense unknown
R4807:Ighg2b UTSW 12 113304345 unclassified probably benign
R4822:Ighg2b UTSW 12 113306391 makesense probably null
R5424:Ighg2b UTSW 12 113307930 missense unknown
R5641:Ighg2b UTSW 12 113307147 missense unknown
R6701:Ighg2b UTSW 12 113307079 missense unknown
R6703:Ighg2b UTSW 12 113305033 unclassified probably benign
R6880:Ighg2b UTSW 12 113307106 missense
R7342:Ighg2b UTSW 12 113306430 missense
R7505:Ighg2b UTSW 12 113304980 missense
R7908:Ighg2b UTSW 12 113306454 missense
R7989:Ighg2b UTSW 12 113306454 missense
Predicted Primers PCR Primer
(F):5'- TACTTGTGGAGCTCTGACTAGCC -3'
(R):5'- TGATCTCCCTGACACCCAAG -3'

Sequencing Primer
(F):5'- AGCTCTGACTAGCCCTGTG -3'
(R):5'- TGACACCCAAGGTCACGTGTG -3'
Posted On2018-04-02