Incidental Mutation 'R6297:Washc5'
ID 508860
Institutional Source Beutler Lab
Gene Symbol Washc5
Ensembl Gene ENSMUSG00000022350
Gene Name WASH complex subunit 5
Synonyms strumpellin, E430025E21Rik
MMRRC Submission 044464-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.956) question?
Stock # R6297 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 59203846-59246016 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 59215895 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 378 (I378T)
Ref Sequence ENSEMBL: ENSMUSP00000154441 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022976] [ENSMUST00000227725]
AlphaFold Q8C2E7
Predicted Effect probably benign
Transcript: ENSMUST00000022976
AA Change: I828T

PolyPhen 2 Score 0.426 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000022976
Gene: ENSMUSG00000022350
AA Change: I828T

DomainStartEndE-ValueType
Pfam:Strumpellin 23 1103 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000227725
AA Change: I378T

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
Meta Mutation Damage Score 0.7158 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.4%
Validation Efficiency 98% (45/46)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 134 kDa protein named strumpellin that is predicted to have multiple transmembrane domains and a spectrin-repeat-containing domain. This ubiquitously expressed gene has its highest expression in skeletal muscle. The protein is named for Strumpell disease; a form of hereditary spastic paraplegia (HSP). Spastic paraplegias are a diverse group of disorders in which the autosomal dominant forms are characterized by progressive, lower extremity spasticity caused by axonal degeneration in the terminal portions of the longest descending and ascending corticospinal tracts. More than 30 loci (SPG1-33) have been implicated in hereditary spastic paraplegia diseases. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal coat color and melanocyte stem cells but enlarged, clustered WASH- and WAFL-positive vesicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T C 3: 121,926,179 (GRCm39) V1205A probably benign Het
Adgra3 G A 5: 50,118,189 (GRCm39) P1120S probably benign Het
Ate1 A G 7: 130,105,570 (GRCm39) V316A probably damaging Het
Bpifa1 A G 2: 153,986,180 (GRCm39) I102V probably benign Het
Catsperb A G 12: 101,557,655 (GRCm39) probably null Het
Ccdc47 T C 11: 106,094,427 (GRCm39) Y324C probably damaging Het
Cdh22 T C 2: 164,985,564 (GRCm39) K341E possibly damaging Het
Cenpb A G 2: 131,020,289 (GRCm39) probably benign Het
Dgkd A G 1: 87,853,866 (GRCm39) I570V possibly damaging Het
Dhx32 A T 7: 133,344,529 (GRCm39) Y27N probably damaging Het
Dnah10 A G 5: 124,852,144 (GRCm39) D1824G possibly damaging Het
Fbxo8 T A 8: 57,022,323 (GRCm39) C112S probably damaging Het
Fndc3a T C 14: 72,800,980 (GRCm39) D590G probably damaging Het
Gm19965 T A 1: 116,750,410 (GRCm39) I697N possibly damaging Het
Greb1l G A 18: 10,469,494 (GRCm39) D170N probably damaging Het
Haus5 C T 7: 30,358,401 (GRCm39) W298* probably null Het
Igfn1 A T 1: 135,892,399 (GRCm39) probably null Het
Ighg2b T C 12: 113,270,512 (GRCm39) E206G unknown Het
Ints15 A T 5: 143,293,787 (GRCm39) L230Q possibly damaging Het
Lman2 T C 13: 55,496,244 (GRCm39) N267S probably damaging Het
Lrfn5 A T 12: 61,890,348 (GRCm39) I546F probably benign Het
Lrrc4c T C 2: 97,459,964 (GRCm39) S197P probably damaging Het
Mbtd1 C T 11: 93,823,058 (GRCm39) H493Y possibly damaging Het
Mdga2 A G 12: 66,553,027 (GRCm39) Y793H probably damaging Het
Mdn1 C T 4: 32,730,054 (GRCm39) R2799* probably null Het
Mup13 T A 4: 61,181,634 (GRCm39) I148F probably benign Het
Or2aj5 A C 16: 19,424,680 (GRCm39) V246G possibly damaging Het
Or5m10 A G 2: 85,717,159 (GRCm39) N5S probably benign Het
Or8g53 A T 9: 39,683,522 (GRCm39) D191E possibly damaging Het
Pdgfra A G 5: 75,334,135 (GRCm39) K403E possibly damaging Het
Pigz A T 16: 31,763,755 (GRCm39) Y271F probably damaging Het
Plekhg4 T C 8: 106,104,472 (GRCm39) L517P probably damaging Het
Rnf20 T C 4: 49,642,132 (GRCm39) L232P probably damaging Het
Rpa3 C A 6: 8,256,767 (GRCm39) G71* probably null Het
Rsf1 GCG GCGACGGCGTCG 7: 97,229,114 (GRCm39) probably benign Het
Rubcnl A G 14: 75,287,584 (GRCm39) T623A probably benign Het
Sltm A G 9: 70,488,641 (GRCm39) D597G probably damaging Het
Stpg2 T C 3: 139,407,432 (GRCm39) V528A possibly damaging Het
Supt6 C T 11: 78,116,885 (GRCm39) R589Q possibly damaging Het
Tas1r2 T A 4: 139,389,361 (GRCm39) M419K possibly damaging Het
Txndc16 T C 14: 45,389,243 (GRCm39) T486A probably benign Het
Vamp9 A G 5: 100,089,092 (GRCm39) Y119C probably damaging Het
Vmn1r185 A G 7: 26,311,046 (GRCm39) V153A probably benign Het
Vmn2r48 T C 7: 9,668,807 (GRCm39) N548D probably damaging Het
Wdr37 A G 13: 8,892,764 (GRCm39) probably null Het
Xrn2 G A 2: 146,868,490 (GRCm39) R181H probably damaging Het
Ylpm1 C G 12: 85,062,051 (GRCm39) P651A unknown Het
Other mutations in Washc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Washc5 APN 15 59,209,125 (GRCm39) missense probably damaging 0.99
IGL01096:Washc5 APN 15 59,222,060 (GRCm39) splice site probably benign
IGL01305:Washc5 APN 15 59,227,688 (GRCm39) nonsense probably null
IGL01707:Washc5 APN 15 59,213,864 (GRCm39) missense possibly damaging 0.89
IGL01921:Washc5 APN 15 59,213,958 (GRCm39) splice site probably null
IGL02056:Washc5 APN 15 59,222,185 (GRCm39) missense possibly damaging 0.63
IGL02145:Washc5 APN 15 59,241,060 (GRCm39) missense probably benign
IGL02430:Washc5 APN 15 59,238,140 (GRCm39) missense probably damaging 1.00
IGL02450:Washc5 APN 15 59,204,166 (GRCm39) nonsense probably null
IGL03238:Washc5 APN 15 59,218,691 (GRCm39) missense probably damaging 1.00
IGL03351:Washc5 APN 15 59,235,199 (GRCm39) splice site probably benign
ANU22:Washc5 UTSW 15 59,227,688 (GRCm39) nonsense probably null
R0004:Washc5 UTSW 15 59,239,316 (GRCm39) missense probably damaging 1.00
R0004:Washc5 UTSW 15 59,239,316 (GRCm39) missense probably damaging 1.00
R0100:Washc5 UTSW 15 59,215,947 (GRCm39) missense possibly damaging 0.83
R0100:Washc5 UTSW 15 59,215,947 (GRCm39) missense possibly damaging 0.83
R0179:Washc5 UTSW 15 59,224,379 (GRCm39) missense probably benign 0.01
R0265:Washc5 UTSW 15 59,210,809 (GRCm39) missense probably benign 0.43
R0315:Washc5 UTSW 15 59,213,825 (GRCm39) missense probably damaging 1.00
R0545:Washc5 UTSW 15 59,213,942 (GRCm39) missense possibly damaging 0.50
R0611:Washc5 UTSW 15 59,213,007 (GRCm39) missense probably damaging 0.99
R0636:Washc5 UTSW 15 59,231,258 (GRCm39) missense probably benign 0.01
R1006:Washc5 UTSW 15 59,241,036 (GRCm39) missense probably benign 0.06
R1006:Washc5 UTSW 15 59,241,035 (GRCm39) missense probably benign 0.21
R1237:Washc5 UTSW 15 59,210,757 (GRCm39) splice site probably benign
R1835:Washc5 UTSW 15 59,231,189 (GRCm39) missense possibly damaging 0.86
R1888:Washc5 UTSW 15 59,231,174 (GRCm39) missense probably damaging 0.99
R1888:Washc5 UTSW 15 59,231,174 (GRCm39) missense probably damaging 0.99
R2005:Washc5 UTSW 15 59,213,004 (GRCm39) missense possibly damaging 0.89
R2006:Washc5 UTSW 15 59,213,004 (GRCm39) missense possibly damaging 0.89
R2060:Washc5 UTSW 15 59,222,257 (GRCm39) missense probably damaging 1.00
R2134:Washc5 UTSW 15 59,241,083 (GRCm39) missense probably damaging 1.00
R2139:Washc5 UTSW 15 59,221,991 (GRCm39) missense probably damaging 1.00
R2177:Washc5 UTSW 15 59,235,118 (GRCm39) nonsense probably null
R2975:Washc5 UTSW 15 59,217,207 (GRCm39) missense probably damaging 1.00
R4088:Washc5 UTSW 15 59,211,711 (GRCm39) missense probably damaging 1.00
R4824:Washc5 UTSW 15 59,205,485 (GRCm39) nonsense probably null
R4843:Washc5 UTSW 15 59,222,220 (GRCm39) missense possibly damaging 0.95
R4991:Washc5 UTSW 15 59,215,929 (GRCm39) missense probably damaging 1.00
R4996:Washc5 UTSW 15 59,205,484 (GRCm39) missense probably benign
R5103:Washc5 UTSW 15 59,222,018 (GRCm39) missense probably damaging 1.00
R5312:Washc5 UTSW 15 59,217,377 (GRCm39) splice site probably null
R5591:Washc5 UTSW 15 59,241,012 (GRCm39) missense probably damaging 1.00
R6073:Washc5 UTSW 15 59,207,019 (GRCm39) missense possibly damaging 0.90
R6123:Washc5 UTSW 15 59,206,959 (GRCm39) missense probably damaging 1.00
R6156:Washc5 UTSW 15 59,217,248 (GRCm39) missense probably damaging 1.00
R6292:Washc5 UTSW 15 59,227,783 (GRCm39) missense probably damaging 1.00
R6374:Washc5 UTSW 15 59,209,044 (GRCm39) missense probably benign 0.14
R6659:Washc5 UTSW 15 59,212,739 (GRCm39) critical splice donor site probably null
R6880:Washc5 UTSW 15 59,222,021 (GRCm39) missense probably benign 0.00
R7146:Washc5 UTSW 15 59,224,350 (GRCm39) nonsense probably null
R7330:Washc5 UTSW 15 59,205,516 (GRCm39) missense probably benign 0.02
R7430:Washc5 UTSW 15 59,241,762 (GRCm39) nonsense probably null
R7490:Washc5 UTSW 15 59,209,053 (GRCm39) missense probably benign 0.18
R7532:Washc5 UTSW 15 59,239,260 (GRCm39) missense possibly damaging 0.46
R7560:Washc5 UTSW 15 59,238,041 (GRCm39) missense probably damaging 0.97
R7803:Washc5 UTSW 15 59,240,308 (GRCm39) missense probably damaging 0.98
R8242:Washc5 UTSW 15 59,215,971 (GRCm39) missense probably damaging 1.00
R8841:Washc5 UTSW 15 59,206,971 (GRCm39) missense probably damaging 1.00
R9022:Washc5 UTSW 15 59,233,069 (GRCm39) missense probably damaging 1.00
R9022:Washc5 UTSW 15 59,217,233 (GRCm39) missense possibly damaging 0.95
R9123:Washc5 UTSW 15 59,209,134 (GRCm39) missense probably damaging 1.00
R9125:Washc5 UTSW 15 59,209,134 (GRCm39) missense probably damaging 1.00
R9310:Washc5 UTSW 15 59,218,067 (GRCm39) missense possibly damaging 0.89
R9423:Washc5 UTSW 15 59,227,735 (GRCm39) missense probably benign
R9556:Washc5 UTSW 15 59,218,716 (GRCm39) missense possibly damaging 0.95
R9569:Washc5 UTSW 15 59,215,980 (GRCm39) missense probably benign
R9668:Washc5 UTSW 15 59,218,062 (GRCm39) critical splice donor site probably null
R9691:Washc5 UTSW 15 59,218,706 (GRCm39) missense probably damaging 1.00
R9718:Washc5 UTSW 15 59,217,192 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTGGCATGATCTAGGTACATGC -3'
(R):5'- GCACTGCTTGTAAGATTGTGTAAAG -3'

Sequencing Primer
(F):5'- CACCTCAGATGCCTGTAAGGAGTG -3'
(R):5'- ACTGGCAGAGTATGTACC -3'
Posted On 2018-04-02