Mutagenetix > Incidental Mutations

Incidental Mutation 'R6298:Rasal2'

508865

Institutional Source

Beutler Lab

Gene Symbol

Rasal2

Ensembl Gene

ENSMUSG00000070565

Gene Name

RAS protein activator like 2

Synonyms

A330066M24Rik

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6298 (G1)

Quality Score

193.009

Status

Validated

Chromosome

Chromosomal Location

157135182-157412595 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 157411862 bp

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 8 (D8G)

Ref Sequence

ENSEMBL: ENSMUSP00000114964 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000078308] [ENSMUST00000132699]

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000061537

Predicted Effect

possibly damaging
Transcript: ENSMUST00000078308
AA Change: D26G

PolyPhen 2 Score 0.828 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000077423
Gene: ENSMUSG00000070565
AA Change: D26G

Domain	Start	End	E-Value	Type
low complexity region	36	47	N/A	INTRINSIC
PH	58	307	3.97e-8	SMART
C2	317	413	6.01e-10	SMART
RasGAP	423	767	4.56e-157	SMART
low complexity region	780	791	N/A	INTRINSIC
low complexity region	1063	1075	N/A	INTRINSIC
low complexity region	1084	1092	N/A	INTRINSIC
coiled coil region	1117	1236	N/A	INTRINSIC

Predicted Effect

possibly damaging
Transcript: ENSMUST00000132699
AA Change: D8G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000114964
Gene: ENSMUSG00000070565
AA Change: D8G

Domain	Start	End	E-Value	Type
low complexity region	18	29	N/A	INTRINSIC
PH	40	289	1.7e-10	SMART
C2	299	395	4e-12	SMART
RasGAP	405	742	4.2e-153	SMART
low complexity region	755	766	N/A	INTRINSIC
low complexity region	1038	1050	N/A	INTRINSIC
low complexity region	1059	1067	N/A	INTRINSIC
coiled coil region	1092	1211	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143080

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000187761

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000194868

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

98% (79/81)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that contains the GAP-related domain (GRD), a characteristic domain of GTPase-activating proteins (GAPs). GAPs function as activators of Ras superfamily of small GTPases. The protein encoded by this gene is able to complement the defective RasGAP function in a yeast system. Two alternatively spliced transcript variants of this gene encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced survival and decreased tumor latency. In other tumorigenic models, this allele promotes increase metastatic potential. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024P04Rik	T	A	13: 98,984,466	R17S	probably benign	Het
Abtb2	A	T	2: 103,709,488	M733L	probably benign	Het
Acss3	G	A	10: 107,084,856	P131L	probably damaging	Het
Adgrv1	T	A	13: 81,391,767	I5678F	probably benign	Het
Aff1	C	T	5: 103,754,720	L6F	possibly damaging	Het
AI314180	T	G	4: 58,877,157	T93P	probably damaging	Het
Ank3	G	T	10: 69,850,176	R273L	probably damaging	Het
Anks1b	G	A	10: 90,680,837	G898D	probably damaging	Het
Anxa11	C	T	14: 25,872,734	P131S	unknown	Het
Ap4e1	T	A	2: 127,047,115	M500K	probably benign	Het
Bag3	T	C	7: 128,540,198	S138P	probably damaging	Het
Capn9	T	C	8: 124,617,454	V670A	probably benign	Het
Ccne2	T	A	4: 11,199,306	W236R	probably damaging	Het
Cdh23	A	T	10: 60,426,672	Y702*	probably null	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cit	A	T	5: 115,948,065	E896V	probably damaging	Het
Cntln	T	A	4: 85,096,761	N1096K	probably damaging	Het
Cntnap5c	T	C	17: 58,104,752	C544R	probably damaging	Het
Csf1	A	T	3: 107,748,359	L452Q	possibly damaging	Het
Cts8	T	A	13: 61,249,223	K294N	possibly damaging	Het
D430042O09Rik	T	C	7: 125,870,697	V1446A	probably benign	Het
Dcakd	T	G	11: 102,999,792	E56D	possibly damaging	Het
Dnah17	T	C	11: 118,108,161	I929V	probably benign	Het
Dnah2	G	T	11: 69,491,641	H1214Q	probably benign	Het
Dock9	T	C	14: 121,634,594	D536G	probably damaging	Het
Drc3	A	G	11: 60,393,770	N467S	possibly damaging	Het
Dysf	A	G	6: 84,107,136		probably null	Het
Evpl	A	T	11: 116,230,922	L378Q	probably damaging	Het
Fer1l4	A	T	2: 156,024,740	H1520Q	probably damaging	Het
Fhod1	A	T	8: 105,337,148		probably benign	Het
Gabra1	T	A	11: 42,182,378		probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm14137	A	G	2: 119,175,091	T44A	possibly damaging	Het
Gm9833	T	C	3: 10,089,179	I336T	probably damaging	Het
Herc2	T	C	7: 56,191,265	M3444T	probably benign	Het
Igsf5	T	C	16: 96,396,448	S208P	possibly damaging	Het
Ino80b	A	G	6: 83,125,085	L12P	possibly damaging	Het
Insrr	A	G	3: 87,812,965	D970G	probably damaging	Het
Iqcf4	G	A	9: 106,568,675	A91V	probably benign	Het
Itga10	A	G	3: 96,656,762	T911A	probably benign	Het
Klhl30	A	T	1: 91,357,364	D314V	probably benign	Het
Lpcat1	T	C	13: 73,510,955	V330A	possibly damaging	Het
Nhlrc3	A	T	3: 53,452,523	D306E	possibly damaging	Het
Notum	T	A	11: 120,657,940	I187F	probably damaging	Het
Nphp3	T	C	9: 104,015,441	L288P	probably damaging	Het
Ntrk2	G	T	13: 58,871,756	E394*	probably null	Het
Olfr420	T	A	1: 174,152,182	V222D	probably benign	Het
Pbld2	A	G	10: 63,039,152	K63E	probably benign	Het
Phc2	T	C	4: 128,748,189	M768T	possibly damaging	Het
Pik3c2g	G	A	6: 139,626,563	C249Y	probably damaging	Het
Plod1	G	A	4: 147,916,315		probably benign	Het
Plscr2	A	T	9: 92,290,719	T9S	probably benign	Het
Pnrc1	T	A	4: 33,246,315	M215L	probably benign	Het
Prcp	G	T	7: 92,928,633	C370F	probably damaging	Het
Pter	A	G	2: 12,978,394	N70S	probably damaging	Het
Ptprt	G	T	2: 161,553,859	H1131Q	probably damaging	Het
Rcn2	A	C	9: 56,052,925	K159Q	probably benign	Het
Rex2	T	A	4: 147,057,515	C153*	probably null	Het
Rps6ka2	T	C	17: 7,170,367	F8S	possibly damaging	Het
Samd9l	A	G	6: 3,375,383	L626S	probably damaging	Het
Sptb	A	G	12: 76,620,654		probably null	Het
Srgap3	A	T	6: 112,816,610	V135D	probably damaging	Het
Srsf7	T	C	17: 80,207,253		probably benign	Het
Tacc2	A	G	7: 130,626,525	T1647A	probably benign	Het
Thap12	G	T	7: 98,703,405	A6S	probably damaging	Het
Tmem33	T	A	5: 67,268,551	L146*	probably null	Het
Trip13	C	A	13: 73,936,259	E36*	probably null	Het
Vkorc1l1	T	A	5: 129,942,238	C23S	probably damaging	Het
Vmn1r20	G	A	6: 57,432,127	R146H	probably benign	Het
Vmn1r222	T	A	13: 23,232,795	I83F	probably benign	Het
Vmn2r107	A	T	17: 20,355,782	I125F	probably benign	Het
Vmn2r116	A	G	17: 23,386,762	D216G	probably damaging	Het
Vwa3a	C	T	7: 120,795,651	T898I	probably benign	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Wdhd1	T	C	14: 47,273,122	D148G	possibly damaging	Het
Xylt1	T	C	7: 117,656,737	I844T	probably damaging	Het
Zfp106	A	T	2: 120,522,704	V1535D	probably damaging	Het
Zfp385b	A	T	2: 77,413,979	L315Q	possibly damaging	Het
Zfp458	T	A	13: 67,256,806	H523L	probably damaging	Het
Zfp712	T	C	13: 67,041,329	H378R	probably damaging	Het
Zic1	T	C	9: 91,364,503	Y172C	probably damaging	Het

Other mutations in Rasal2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00473:Rasal2	APN	1	157147817	missense	probably benign
IGL00484:Rasal2	APN	1	157174175	unclassified	probably null
IGL00731:Rasal2	APN	1	157157764	missense	probably benign	0.01
IGL00900:Rasal2	APN	1	157411929	missense	possibly damaging	0.73
IGL01346:Rasal2	APN	1	157161216	missense	probably benign	0.19
IGL01635:Rasal2	APN	1	157163824	missense	probably damaging	1.00
IGL01759:Rasal2	APN	1	157175932	missense	probably benign	0.42
IGL01939:Rasal2	APN	1	157175910	missense	probably damaging	1.00
IGL01954:Rasal2	APN	1	157177699	missense	possibly damaging	0.83
IGL01954:Rasal2	APN	1	157176116	missense	probably damaging	0.99
IGL02005:Rasal2	APN	1	157156998	nonsense	probably null
IGL02056:Rasal2	APN	1	157299261	missense	probably damaging	0.99
IGL02444:Rasal2	APN	1	157299195	missense	probably benign	0.20
IGL02496:Rasal2	APN	1	157149879	missense	possibly damaging	0.69
IGL02832:Rasal2	APN	1	157157207	missense	probably damaging	1.00
IGL03351:Rasal2	APN	1	157192741	splice site	probably benign
R0456:Rasal2	UTSW	1	157149843	missense	probably damaging	1.00
R0537:Rasal2	UTSW	1	157147792	missense	possibly damaging	0.46
R0681:Rasal2	UTSW	1	157157180	missense	possibly damaging	0.70
R0682:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0683:Rasal2	UTSW	1	157179209	missense	probably damaging	1.00
R0787:Rasal2	UTSW	1	157158696	missense	probably damaging	1.00
R0789:Rasal2	UTSW	1	157157321	missense	probably damaging	1.00
R1109:Rasal2	UTSW	1	157177638	unclassified	probably benign
R1175:Rasal2	UTSW	1	157147648	missense	probably damaging	1.00
R1332:Rasal2	UTSW	1	157175821	missense	probably benign	0.00
R1396:Rasal2	UTSW	1	157164666	missense	probably damaging	1.00
R1535:Rasal2	UTSW	1	157230059	missense	probably benign	0.28
R1542:Rasal2	UTSW	1	157175851	missense	possibly damaging	0.84
R1703:Rasal2	UTSW	1	157157600	missense	probably damaging	1.00
R1735:Rasal2	UTSW	1	157174160	missense	probably damaging	1.00
R1762:Rasal2	UTSW	1	157299144	missense	possibly damaging	0.52
R2570:Rasal2	UTSW	1	157161300	missense	possibly damaging	0.85
R3148:Rasal2	UTSW	1	157243764	intron	probably benign
R3157:Rasal2	UTSW	1	157158655	splice site	probably benign
R4277:Rasal2	UTSW	1	157157126	missense	possibly damaging	0.46
R4459:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4460:Rasal2	UTSW	1	157175832	missense	possibly damaging	0.46
R4563:Rasal2	UTSW	1	157175991	missense	probably damaging	1.00
R4672:Rasal2	UTSW	1	157243661	missense	probably benign	0.10
R4894:Rasal2	UTSW	1	157192804	missense	probably damaging	0.97
R5147:Rasal2	UTSW	1	157175694	missense	probably damaging	1.00
R5387:Rasal2	UTSW	1	157157765	missense	possibly damaging	0.81
R5421:Rasal2	UTSW	1	157299141	missense	probably benign	0.37
R5459:Rasal2	UTSW	1	157157661	missense	probably damaging	0.99
R5651:Rasal2	UTSW	1	157157381	missense	probably damaging	1.00
R5767:Rasal2	UTSW	1	157176162	missense	probably damaging	1.00
R5778:Rasal2	UTSW	1	157161290	missense	probably damaging	1.00
R6332:Rasal2	UTSW	1	157299187	missense	probably damaging	1.00
R6571:Rasal2	UTSW	1	157161179	missense	possibly damaging	0.72
R7258:Rasal2	UTSW	1	157157700	missense	probably damaging	0.96
R7545:Rasal2	UTSW	1	157192769	missense	possibly damaging	0.93
R7558:Rasal2	UTSW	1	157175836	missense	probably damaging	0.99
R7894:Rasal2	UTSW	1	157243648	missense	probably benign	0.01
R7977:Rasal2	UTSW	1	157243648	missense	probably benign	0.01
RF024:Rasal2	UTSW	1	157147790	missense	probably damaging	0.97

Predicted Primers

PCR Primer
(F):5'- TGAGAAACGCCAGCCTCTG -3'
(R):5'- CCAGGCGGACAGAAGCTG -3'

Sequencing Primer
(F):5'- CTCTGAGGCAGACGACTTGTGATC -3'
(R):5'- GCCGAGCTCCATCCTCAG -3'

Posted On

2018-04-02