Mutagenetix > Incidental Mutation

Incidental Mutation 'R6298:Abtb2'

508868

Institutional Source

Beutler Lab

Gene Symbol

Abtb2

Ensembl Gene

ENSMUSG00000032724

Gene Name

ankyrin repeat and BTB (POZ) domain containing 2

Synonyms

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6298 (G1)

Quality Score

167.009

Status

Validated

Chromosome

Chromosomal Location

103566310-103718423 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to T at 103709488 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Leucine at position 733 (M733L)

Ref Sequence

ENSEMBL: ENSMUSP00000075566 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000076212]

AlphaFold

Q7TQI7

Predicted Effect

probably benign
Transcript: ENSMUST00000076212
AA Change: M733L

PolyPhen 2 Score 0.100 (Sensitivity: 0.93; Specificity: 0.86)

SMART Domains

Protein: ENSMUSP00000075566
Gene: ENSMUSG00000032724
AA Change: M733L

Domain	Start	End	E-Value	Type
low complexity region	29	48	N/A	INTRINSIC
low complexity region	122	143	N/A	INTRINSIC
Blast:H2A	186	301	2e-38	BLAST
low complexity region	366	376	N/A	INTRINSIC
ANK	521	550	4.78e-7	SMART
ANK	567	596	6.26e-2	SMART
ANK	606	635	3.65e-3	SMART
ANK	649	678	5.52e2	SMART
ANK	715	746	1.84e3	SMART
BTB	844	946	9.15e-24	SMART

Meta Mutation Damage Score

0.0803

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

98% (79/81)

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024P04Rik	T	A	13: 98,984,466	R17S	probably benign	Het
Acss3	G	A	10: 107,084,856	P131L	probably damaging	Het
Adgrv1	T	A	13: 81,391,767	I5678F	probably benign	Het
Aff1	C	T	5: 103,754,720	L6F	possibly damaging	Het
AI314180	T	G	4: 58,877,157	T93P	probably damaging	Het
Ank3	G	T	10: 69,850,176	R273L	probably damaging	Het
Anks1b	G	A	10: 90,680,837	G898D	probably damaging	Het
Anxa11	C	T	14: 25,872,734	P131S	unknown	Het
Ap4e1	T	A	2: 127,047,115	M500K	probably benign	Het
Bag3	T	C	7: 128,540,198	S138P	probably damaging	Het
Capn9	T	C	8: 124,617,454	V670A	probably benign	Het
Ccne2	T	A	4: 11,199,306	W236R	probably damaging	Het
Cdh23	A	T	10: 60,426,672	Y702*	probably null	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cit	A	T	5: 115,948,065	E896V	probably damaging	Het
Cntln	T	A	4: 85,096,761	N1096K	probably damaging	Het
Cntnap5c	T	C	17: 58,104,752	C544R	probably damaging	Het
Csf1	A	T	3: 107,748,359	L452Q	possibly damaging	Het
Cts8	T	A	13: 61,249,223	K294N	possibly damaging	Het
D430042O09Rik	T	C	7: 125,870,697	V1446A	probably benign	Het
Dcakd	T	G	11: 102,999,792	E56D	possibly damaging	Het
Dnah17	T	C	11: 118,108,161	I929V	probably benign	Het
Dnah2	G	T	11: 69,491,641	H1214Q	probably benign	Het
Dock9	T	C	14: 121,634,594	D536G	probably damaging	Het
Drc3	A	G	11: 60,393,770	N467S	possibly damaging	Het
Dysf	A	G	6: 84,107,136		probably null	Het
Evpl	A	T	11: 116,230,922	L378Q	probably damaging	Het
Fer1l4	A	T	2: 156,024,740	H1520Q	probably damaging	Het
Fhod1	A	T	8: 105,337,148		probably benign	Het
Gabra1	T	A	11: 42,182,378		probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm14137	A	G	2: 119,175,091	T44A	possibly damaging	Het
Gm9833	T	C	3: 10,089,179	I336T	probably damaging	Het
Herc2	T	C	7: 56,191,265	M3444T	probably benign	Het
Igsf5	T	C	16: 96,396,448	S208P	possibly damaging	Het
Ino80b	A	G	6: 83,125,085	L12P	possibly damaging	Het
Insrr	A	G	3: 87,812,965	D970G	probably damaging	Het
Iqcf4	G	A	9: 106,568,675	A91V	probably benign	Het
Itga10	A	G	3: 96,656,762	T911A	probably benign	Het
Klhl30	A	T	1: 91,357,364	D314V	probably benign	Het
Lpcat1	T	C	13: 73,510,955	V330A	possibly damaging	Het
Nhlrc3	A	T	3: 53,452,523	D306E	possibly damaging	Het
Notum	T	A	11: 120,657,940	I187F	probably damaging	Het
Nphp3	T	C	9: 104,015,441	L288P	probably damaging	Het
Ntrk2	G	T	13: 58,871,756	E394*	probably null	Het
Olfr420	T	A	1: 174,152,182	V222D	probably benign	Het
Pbld2	A	G	10: 63,039,152	K63E	probably benign	Het
Phc2	T	C	4: 128,748,189	M768T	possibly damaging	Het
Pik3c2g	G	A	6: 139,626,563	C249Y	probably damaging	Het
Plod1	G	A	4: 147,916,315		probably benign	Het
Plscr2	A	T	9: 92,290,719	T9S	probably benign	Het
Pnrc1	T	A	4: 33,246,315	M215L	probably benign	Het
Prcp	G	T	7: 92,928,633	C370F	probably damaging	Het
Pter	A	G	2: 12,978,394	N70S	probably damaging	Het
Ptprt	G	T	2: 161,553,859	H1131Q	probably damaging	Het
Rasal2	T	C	1: 157,411,862	D8G	possibly damaging	Het
Rcn2	A	C	9: 56,052,925	K159Q	probably benign	Het
Rex2	T	A	4: 147,057,515	C153*	probably null	Het
Rps6ka2	T	C	17: 7,170,367	F8S	possibly damaging	Het
Samd9l	A	G	6: 3,375,383	L626S	probably damaging	Het
Sptb	A	G	12: 76,620,654		probably null	Het
Srgap3	A	T	6: 112,816,610	V135D	probably damaging	Het
Srsf7	T	C	17: 80,207,253		probably benign	Het
Tacc2	A	G	7: 130,626,525	T1647A	probably benign	Het
Thap12	G	T	7: 98,703,405	A6S	probably damaging	Het
Tmem33	T	A	5: 67,268,551	L146*	probably null	Het
Trip13	C	A	13: 73,936,259	E36*	probably null	Het
Vkorc1l1	T	A	5: 129,942,238	C23S	probably damaging	Het
Vmn1r20	G	A	6: 57,432,127	R146H	probably benign	Het
Vmn1r222	T	A	13: 23,232,795	I83F	probably benign	Het
Vmn2r107	A	T	17: 20,355,782	I125F	probably benign	Het
Vmn2r116	A	G	17: 23,386,762	D216G	probably damaging	Het
Vwa3a	C	T	7: 120,795,651	T898I	probably benign	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Wdhd1	T	C	14: 47,273,122	D148G	possibly damaging	Het
Xylt1	T	C	7: 117,656,737	I844T	probably damaging	Het
Zfp106	A	T	2: 120,522,704	V1535D	probably damaging	Het
Zfp385b	A	T	2: 77,413,979	L315Q	possibly damaging	Het
Zfp458	T	A	13: 67,256,806	H523L	probably damaging	Het
Zfp712	T	C	13: 67,041,329	H378R	probably damaging	Het
Zic1	T	C	9: 91,364,503	Y172C	probably damaging	Het

Other mutations in Abtb2

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01161:Abtb2	APN	2	103705118	missense	probably benign	0.00
IGL02605:Abtb2	APN	2	103717257	missense	probably benign
IGL03161:Abtb2	APN	2	103567454	missense	probably benign	0.02
PIT4504001:Abtb2	UTSW	2	103717192	nonsense	probably null
R0147:Abtb2	UTSW	2	103567135	missense	probably benign	0.04
R1052:Abtb2	UTSW	2	103705072	missense	possibly damaging	0.46
R1419:Abtb2	UTSW	2	103709420	missense	probably benign	0.00
R1518:Abtb2	UTSW	2	103709284	missense	probably benign	0.03
R1650:Abtb2	UTSW	2	103702402	missense	probably damaging	1.00
R1795:Abtb2	UTSW	2	103567024	missense	probably benign	0.00
R2054:Abtb2	UTSW	2	103705117	missense	probably benign	0.41
R2101:Abtb2	UTSW	2	103566862	missense	probably benign	0.05
R2363:Abtb2	UTSW	2	103567183	missense	probably damaging	1.00
R3440:Abtb2	UTSW	2	103567232	missense	probably benign	0.43
R3927:Abtb2	UTSW	2	103708218	splice site	probably null
R4351:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4352:Abtb2	UTSW	2	103683393	missense	possibly damaging	0.46
R4782:Abtb2	UTSW	2	103717299	missense	probably benign	0.35
R4814:Abtb2	UTSW	2	103717287	missense	probably benign	0.08
R4831:Abtb2	UTSW	2	103683475	missense	probably benign	0.06
R4900:Abtb2	UTSW	2	103567004	missense	possibly damaging	0.62
R5038:Abtb2	UTSW	2	103567063	missense	probably damaging	0.99
R5513:Abtb2	UTSW	2	103709278	critical splice acceptor site	probably null
R6119:Abtb2	UTSW	2	103702310	missense	probably benign	0.00
R6383:Abtb2	UTSW	2	103567376	missense	probably damaging	0.98
R6860:Abtb2	UTSW	2	103709425	nonsense	probably null
R7000:Abtb2	UTSW	2	103712442	missense	possibly damaging	0.85
R7109:Abtb2	UTSW	2	103715515	missense	probably benign	0.20
R7176:Abtb2	UTSW	2	103709375	missense	probably benign	0.00
R7189:Abtb2	UTSW	2	103567516	missense	probably benign	0.00
R7199:Abtb2	UTSW	2	103567220	missense	possibly damaging	0.74
R7299:Abtb2	UTSW	2	103702424	splice site	probably null
R7347:Abtb2	UTSW	2	103567412	missense	probably damaging	1.00
R7469:Abtb2	UTSW	2	103566947	missense	probably benign	0.00
R7629:Abtb2	UTSW	2	103683493	critical splice donor site	probably null
R7862:Abtb2	UTSW	2	103702281	missense	probably damaging	1.00
R8200:Abtb2	UTSW	2	103700817	missense	probably benign	0.02
R8682:Abtb2	UTSW	2	103567375	missense	probably benign	0.36
R8700:Abtb2	UTSW	2	103566944	missense	probably damaging	0.99
R9164:Abtb2	UTSW	2	103711484	missense	possibly damaging	0.50
R9196:Abtb2	UTSW	2	103683302	missense	possibly damaging	0.71
R9254:Abtb2	UTSW	2	103711235	missense	probably benign	0.00
R9258:Abtb2	UTSW	2	103716065	missense	probably null	0.99
R9343:Abtb2	UTSW	2	103717160	missense	probably benign
R9427:Abtb2	UTSW	2	103700899	missense	probably damaging	1.00
R9675:Abtb2	UTSW	2	103708187	missense	probably benign
Z1176:Abtb2	UTSW	2	103708172	nonsense	probably null
Z1177:Abtb2	UTSW	2	103711196	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- CCTGAGAAAGCTCCTGACTC -3'
(R):5'- AGGGTCCTATACACACTCCTG -3'

Sequencing Primer
(F):5'- TGACTCAGCCACAGCAGG -3'
(R):5'- ACTCCTGGTGTGCCATCAG -3'

Posted On

2018-04-02