Incidental Mutation 'R6298:Fer1l4'
ID 508872
Institutional Source Beutler Lab
Gene Symbol Fer1l4
Ensembl Gene ENSMUSG00000013338
Gene Name fer-1 like family member 4
Synonyms 9130402C12Rik
MMRRC Submission 044408-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6298 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 155861059-155894867 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 155866660 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 1520 (H1520Q)
Ref Sequence ENSEMBL: ENSMUSP00000105240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109611]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000109611
AA Change: H1520Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105240
Gene: ENSMUSG00000013338
AA Change: H1520Q

DomainStartEndE-ValueType
PDB:3L9B|A 1 122 1e-12 PDB
Blast:C2 2 96 2e-51 BLAST
low complexity region 159 172 N/A INTRINSIC
low complexity region 178 197 N/A INTRINSIC
C2 228 329 2.87e-7 SMART
FerI 312 383 7.93e-29 SMART
C2 391 501 3.64e-9 SMART
low complexity region 574 581 N/A INTRINSIC
low complexity region 611 622 N/A INTRINSIC
low complexity region 829 837 N/A INTRINSIC
low complexity region 844 855 N/A INTRINSIC
FerB 861 932 7.27e-37 SMART
C2 968 1076 3.73e-6 SMART
low complexity region 1249 1257 N/A INTRINSIC
low complexity region 1280 1310 N/A INTRINSIC
low complexity region 1327 1340 N/A INTRINSIC
low complexity region 1397 1407 N/A INTRINSIC
C2 1449 1548 5.65e-15 SMART
C2 1692 1822 4.22e-5 SMART
Pfam:Ferlin_C 1834 1987 1.6e-74 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000132912
SMART Domains Protein: ENSMUSP00000123091
Gene: ENSMUSG00000013338

DomainStartEndE-ValueType
low complexity region 14 27 N/A INTRINSIC
low complexity region 84 94 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138297
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150144
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150538
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb2 A T 2: 103,539,833 (GRCm39) M733L probably benign Het
Acss3 G A 10: 106,920,717 (GRCm39) P131L probably damaging Het
Adgrv1 T A 13: 81,539,886 (GRCm39) I5678F probably benign Het
Aff1 C T 5: 103,902,586 (GRCm39) L6F possibly damaging Het
Ank3 G T 10: 69,686,006 (GRCm39) R273L probably damaging Het
Anks1b G A 10: 90,516,699 (GRCm39) G898D probably damaging Het
Anxa11 C T 14: 25,873,158 (GRCm39) P131S unknown Het
Ap4e1 T A 2: 126,889,035 (GRCm39) M500K probably benign Het
Bag3 T C 7: 128,141,922 (GRCm39) S138P probably damaging Het
Capn9 T C 8: 125,344,193 (GRCm39) V670A probably benign Het
Ccne2 T A 4: 11,199,306 (GRCm39) W236R probably damaging Het
Cdh23 A T 10: 60,262,451 (GRCm39) Y702* probably null Het
Chd1l G A 3: 97,494,483 (GRCm39) A399V probably damaging Het
Cit A T 5: 116,086,124 (GRCm39) E896V probably damaging Het
Cntln T A 4: 85,014,998 (GRCm39) N1096K probably damaging Het
Cntnap5c T C 17: 58,411,747 (GRCm39) C544R probably damaging Het
Csf1 A T 3: 107,655,675 (GRCm39) L452Q possibly damaging Het
Cts8 T A 13: 61,397,037 (GRCm39) K294N possibly damaging Het
Dcakd T G 11: 102,890,618 (GRCm39) E56D possibly damaging Het
Dnah17 T C 11: 117,998,987 (GRCm39) I929V probably benign Het
Dnah2 G T 11: 69,382,467 (GRCm39) H1214Q probably benign Het
Dock9 T C 14: 121,872,006 (GRCm39) D536G probably damaging Het
Drc3 A G 11: 60,284,596 (GRCm39) N467S possibly damaging Het
Dysf A G 6: 84,084,118 (GRCm39) probably null Het
Ecpas T G 4: 58,877,157 (GRCm39) T93P probably damaging Het
Evpl A T 11: 116,121,748 (GRCm39) L378Q probably damaging Het
Fhod1 A T 8: 106,063,780 (GRCm39) probably benign Het
Gabra1 T A 11: 42,073,205 (GRCm39) probably benign Het
Gm10549 C A 18: 33,597,358 (GRCm39) probably benign Het
Gm14137 A G 2: 119,005,572 (GRCm39) T44A possibly damaging Het
H2bl1 T A 13: 99,120,974 (GRCm39) R17S probably benign Het
Herc2 T C 7: 55,841,013 (GRCm39) M3444T probably benign Het
Igsf5 T C 16: 96,197,648 (GRCm39) S208P possibly damaging Het
Ino80b A G 6: 83,102,066 (GRCm39) L12P possibly damaging Het
Insrr A G 3: 87,720,272 (GRCm39) D970G probably damaging Het
Iqcf4 G A 9: 106,445,874 (GRCm39) A91V probably benign Het
Itga10 A G 3: 96,564,078 (GRCm39) T911A probably benign Het
Katnip T C 7: 125,469,869 (GRCm39) V1446A probably benign Het
Klhl30 A T 1: 91,285,086 (GRCm39) D314V probably benign Het
Lpcat1 T C 13: 73,659,074 (GRCm39) V330A possibly damaging Het
Myef2l T C 3: 10,154,239 (GRCm39) I336T probably damaging Het
Nhlrc3 A T 3: 53,359,944 (GRCm39) D306E possibly damaging Het
Notum T A 11: 120,548,766 (GRCm39) I187F probably damaging Het
Nphp3 T C 9: 103,892,640 (GRCm39) L288P probably damaging Het
Ntrk2 G T 13: 59,019,570 (GRCm39) E394* probably null Het
Or6k2 T A 1: 173,979,748 (GRCm39) V222D probably benign Het
Pbld2 A G 10: 62,874,931 (GRCm39) K63E probably benign Het
Phc2 T C 4: 128,641,982 (GRCm39) M768T possibly damaging Het
Pik3c2g G A 6: 139,603,561 (GRCm39) C249Y probably damaging Het
Plod1 G A 4: 148,000,772 (GRCm39) probably benign Het
Plscr2 A T 9: 92,172,772 (GRCm39) T9S probably benign Het
Pnrc1 T A 4: 33,246,315 (GRCm39) M215L probably benign Het
Prcp G T 7: 92,577,841 (GRCm39) C370F probably damaging Het
Pter A G 2: 12,983,205 (GRCm39) N70S probably damaging Het
Ptprt G T 2: 161,395,779 (GRCm39) H1131Q probably damaging Het
Rasal2 T C 1: 157,239,432 (GRCm39) D8G possibly damaging Het
Rcn2 A C 9: 55,960,209 (GRCm39) K159Q probably benign Het
Rex2 T A 4: 147,141,972 (GRCm39) C153* probably null Het
Rps6ka2 T C 17: 7,437,766 (GRCm39) F8S possibly damaging Het
Samd9l A G 6: 3,375,383 (GRCm39) L626S probably damaging Het
Sptb A G 12: 76,667,428 (GRCm39) probably null Het
Srgap3 A T 6: 112,793,571 (GRCm39) V135D probably damaging Het
Srsf7 T C 17: 80,514,682 (GRCm39) probably benign Het
Tacc2 A G 7: 130,228,255 (GRCm39) T1647A probably benign Het
Thap12 G T 7: 98,352,612 (GRCm39) A6S probably damaging Het
Tmem33 T A 5: 67,425,894 (GRCm39) L146* probably null Het
Trip13 C A 13: 74,084,378 (GRCm39) E36* probably null Het
Vkorc1l1 T A 5: 129,971,079 (GRCm39) C23S probably damaging Het
Vmn1r20 G A 6: 57,409,112 (GRCm39) R146H probably benign Het
Vmn1r222 T A 13: 23,416,965 (GRCm39) I83F probably benign Het
Vmn2r107 A T 17: 20,576,044 (GRCm39) I125F probably benign Het
Vmn2r116 A G 17: 23,605,736 (GRCm39) D216G probably damaging Het
Vwa3a C T 7: 120,394,874 (GRCm39) T898I probably benign Het
Wdfy3 T C 5: 102,116,812 (GRCm39) D76G probably damaging Het
Wdhd1 T C 14: 47,510,579 (GRCm39) D148G possibly damaging Het
Xylt1 T C 7: 117,255,960 (GRCm39) I844T probably damaging Het
Zfp106 A T 2: 120,353,185 (GRCm39) V1535D probably damaging Het
Zfp385b A T 2: 77,244,323 (GRCm39) L315Q possibly damaging Het
Zfp458 T A 13: 67,404,870 (GRCm39) H523L probably damaging Het
Zfp712 T C 13: 67,189,393 (GRCm39) H378R probably damaging Het
Zic1 T C 9: 91,246,556 (GRCm39) Y172C probably damaging Het
Other mutations in Fer1l4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00417:Fer1l4 APN 2 155,861,840 (GRCm39) nonsense probably null
IGL01025:Fer1l4 APN 2 155,894,105 (GRCm39) missense probably benign 0.41
IGL01103:Fer1l4 APN 2 155,886,361 (GRCm39) critical splice donor site probably null
IGL01322:Fer1l4 APN 2 155,862,259 (GRCm39) splice site probably null
IGL01391:Fer1l4 APN 2 155,878,376 (GRCm39) missense probably damaging 1.00
IGL02176:Fer1l4 APN 2 155,890,371 (GRCm39) missense probably benign
IGL02267:Fer1l4 APN 2 155,873,172 (GRCm39) missense possibly damaging 0.60
IGL02291:Fer1l4 APN 2 155,861,458 (GRCm39) missense probably damaging 1.00
IGL02385:Fer1l4 APN 2 155,887,348 (GRCm39) missense probably benign 0.04
IGL02423:Fer1l4 APN 2 155,894,827 (GRCm39) missense probably benign 0.04
IGL02596:Fer1l4 APN 2 155,881,052 (GRCm39) missense probably benign
IGL02612:Fer1l4 APN 2 155,889,848 (GRCm39) missense probably damaging 1.00
IGL02716:Fer1l4 APN 2 155,871,635 (GRCm39) missense probably damaging 1.00
IGL02738:Fer1l4 APN 2 155,887,648 (GRCm39) missense probably benign
IGL03035:Fer1l4 APN 2 155,864,526 (GRCm39) missense possibly damaging 0.95
IGL03083:Fer1l4 APN 2 155,881,286 (GRCm39) unclassified probably benign
IGL03201:Fer1l4 APN 2 155,886,650 (GRCm39) missense probably benign 0.32
IGL03349:Fer1l4 APN 2 155,886,654 (GRCm39) nonsense probably null
R0033:Fer1l4 UTSW 2 155,866,026 (GRCm39) splice site probably benign
R0356:Fer1l4 UTSW 2 155,865,930 (GRCm39) missense probably damaging 1.00
R0477:Fer1l4 UTSW 2 155,894,806 (GRCm39) missense probably benign 0.43
R0504:Fer1l4 UTSW 2 155,894,115 (GRCm39) missense probably benign 0.36
R0731:Fer1l4 UTSW 2 155,865,990 (GRCm39) missense probably benign 0.17
R0800:Fer1l4 UTSW 2 155,887,583 (GRCm39) missense possibly damaging 0.90
R0884:Fer1l4 UTSW 2 155,861,233 (GRCm39) missense possibly damaging 0.93
R1017:Fer1l4 UTSW 2 155,891,398 (GRCm39) critical splice acceptor site probably null
R1266:Fer1l4 UTSW 2 155,888,169 (GRCm39) missense possibly damaging 0.89
R1544:Fer1l4 UTSW 2 155,887,553 (GRCm39) missense probably benign 0.00
R1657:Fer1l4 UTSW 2 155,877,518 (GRCm39) missense possibly damaging 0.95
R1699:Fer1l4 UTSW 2 155,871,605 (GRCm39) missense probably benign 0.14
R1816:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R1950:Fer1l4 UTSW 2 155,890,194 (GRCm39) missense probably damaging 1.00
R2117:Fer1l4 UTSW 2 155,881,038 (GRCm39) missense probably benign 0.00
R2219:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2220:Fer1l4 UTSW 2 155,873,684 (GRCm39) missense probably damaging 0.99
R2879:Fer1l4 UTSW 2 155,894,120 (GRCm39) missense probably damaging 1.00
R3746:Fer1l4 UTSW 2 155,876,968 (GRCm39) missense probably benign 0.01
R3806:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R3807:Fer1l4 UTSW 2 155,887,603 (GRCm39) missense probably damaging 1.00
R4224:Fer1l4 UTSW 2 155,862,309 (GRCm39) missense probably benign 0.37
R4274:Fer1l4 UTSW 2 155,862,464 (GRCm39) missense probably damaging 1.00
R4569:Fer1l4 UTSW 2 155,878,559 (GRCm39) missense possibly damaging 0.77
R4619:Fer1l4 UTSW 2 155,889,007 (GRCm39) missense probably damaging 1.00
R4707:Fer1l4 UTSW 2 155,887,543 (GRCm39) missense possibly damaging 0.69
R4914:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4915:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4917:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4918:Fer1l4 UTSW 2 155,873,220 (GRCm39) missense probably benign 0.41
R4941:Fer1l4 UTSW 2 155,887,009 (GRCm39) missense probably damaging 1.00
R5011:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5013:Fer1l4 UTSW 2 155,873,135 (GRCm39) missense probably damaging 1.00
R5130:Fer1l4 UTSW 2 155,891,386 (GRCm39) missense possibly damaging 0.54
R5385:Fer1l4 UTSW 2 155,879,286 (GRCm39) nonsense probably null
R5441:Fer1l4 UTSW 2 155,865,177 (GRCm39) missense probably benign 0.00
R5555:Fer1l4 UTSW 2 155,890,109 (GRCm39) missense probably damaging 1.00
R5838:Fer1l4 UTSW 2 155,893,913 (GRCm39) missense probably benign 0.01
R6125:Fer1l4 UTSW 2 155,888,907 (GRCm39) missense probably damaging 1.00
R6184:Fer1l4 UTSW 2 155,890,211 (GRCm39) missense probably damaging 1.00
R6246:Fer1l4 UTSW 2 155,866,902 (GRCm39) missense probably damaging 0.99
R6248:Fer1l4 UTSW 2 155,888,091 (GRCm39) missense probably damaging 1.00
R6274:Fer1l4 UTSW 2 155,871,188 (GRCm39) missense probably damaging 1.00
R6362:Fer1l4 UTSW 2 155,890,170 (GRCm39) missense probably benign 0.08
R6490:Fer1l4 UTSW 2 155,889,834 (GRCm39) missense possibly damaging 0.94
R6494:Fer1l4 UTSW 2 155,887,390 (GRCm39) missense probably benign 0.02
R6516:Fer1l4 UTSW 2 155,877,119 (GRCm39) missense probably damaging 0.98
R6530:Fer1l4 UTSW 2 155,889,785 (GRCm39) critical splice donor site probably null
R6740:Fer1l4 UTSW 2 155,873,142 (GRCm39) missense probably damaging 1.00
R7039:Fer1l4 UTSW 2 155,878,650 (GRCm39) missense probably benign 0.05
R7121:Fer1l4 UTSW 2 155,886,477 (GRCm39) missense probably benign 0.13
R7132:Fer1l4 UTSW 2 155,887,546 (GRCm39) missense probably damaging 0.98
R7382:Fer1l4 UTSW 2 155,862,669 (GRCm39) nonsense probably null
R7631:Fer1l4 UTSW 2 155,890,195 (GRCm39) missense probably damaging 1.00
R7693:Fer1l4 UTSW 2 155,862,351 (GRCm39) missense possibly damaging 0.51
R7730:Fer1l4 UTSW 2 155,890,854 (GRCm39) missense probably benign
R8021:Fer1l4 UTSW 2 155,864,511 (GRCm39) missense probably damaging 0.98
R8161:Fer1l4 UTSW 2 155,866,555 (GRCm39) missense probably benign 0.03
R8171:Fer1l4 UTSW 2 155,890,151 (GRCm39) missense probably benign 0.29
R8241:Fer1l4 UTSW 2 155,891,585 (GRCm39) missense probably benign
R8245:Fer1l4 UTSW 2 155,886,934 (GRCm39) critical splice donor site probably null
R8280:Fer1l4 UTSW 2 155,891,620 (GRCm39) missense probably damaging 1.00
R8369:Fer1l4 UTSW 2 155,861,680 (GRCm39) missense probably benign 0.17
R8403:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense possibly damaging 0.88
R8702:Fer1l4 UTSW 2 155,861,310 (GRCm39) missense probably benign 0.00
R8804:Fer1l4 UTSW 2 155,893,914 (GRCm39) missense probably benign 0.28
R8814:Fer1l4 UTSW 2 155,894,163 (GRCm39) missense probably benign 0.04
R8817:Fer1l4 UTSW 2 155,890,143 (GRCm39) missense probably damaging 0.99
R9325:Fer1l4 UTSW 2 155,877,934 (GRCm39) missense probably damaging 1.00
R9342:Fer1l4 UTSW 2 155,877,196 (GRCm39) missense probably benign 0.08
R9527:Fer1l4 UTSW 2 155,871,617 (GRCm39) missense probably damaging 0.96
R9661:Fer1l4 UTSW 2 155,862,336 (GRCm39) missense probably damaging 0.98
RF030:Fer1l4 UTSW 2 155,887,449 (GRCm39) small deletion probably benign
X0063:Fer1l4 UTSW 2 155,876,931 (GRCm39) missense probably damaging 1.00
Z1177:Fer1l4 UTSW 2 155,890,349 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- GGGGATGTGAGCTTCGCAG -3'
(R):5'- CCCCATCTTTGGAGAGTGAG -3'

Sequencing Primer
(F):5'- ATGTGAGCTTCGCAGGTGTTTG -3'
(R):5'- AGAGTGAGGCTGGGCTC -3'
Posted On 2018-04-02