Incidental Mutation 'R6298:Ccne2'
ID508880
Institutional Source Beutler Lab
Gene Symbol Ccne2
Ensembl Gene ENSMUSG00000028212
Gene Namecyclin E2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6298 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location11191351-11204779 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 11199306 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 236 (W236R)
Ref Sequence ENSEMBL: ENSMUSP00000130693 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029866] [ENSMUST00000044616] [ENSMUST00000108324] [ENSMUST00000170901]
Predicted Effect probably damaging
Transcript: ENSMUST00000029866
AA Change: W235R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029866
Gene: ENSMUSG00000028212
AA Change: W235R

DomainStartEndE-ValueType
CYCLIN 146 231 2.16e-24 SMART
Cyclin_C 240 362 5.49e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000044616
SMART Domains Protein: ENSMUSP00000038418
Gene: ENSMUSG00000040738

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 80 93 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108324
AA Change: W236R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103960
Gene: ENSMUSG00000028212
AA Change: W236R

DomainStartEndE-ValueType
CYCLIN 147 232 2.16e-24 SMART
Cyclin_C 241 363 5.49e-14 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136545
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144438
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147725
Predicted Effect probably damaging
Transcript: ENSMUST00000170901
AA Change: W236R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130693
Gene: ENSMUSG00000028212
AA Change: W236R

DomainStartEndE-ValueType
CYCLIN 147 232 2.16e-24 SMART
Cyclin_C 241 363 5.49e-14 SMART
Meta Mutation Damage Score 0.9617 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the highly conserved cyclin family, whose members are characterized by a dramatic periodicity in protein abundance through the cell cycle. Cyclins function as regulators of CDK kinases. Different cyclins exhibit distinct expression and degradation patterns which contribute to the temporal coordination of each mitotic event. This cyclin forms a complex with and functions as a regulatory subunit of CDK2. This cyclin has been shown to specifically interact with CIP/KIP family of CDK inhibitors, and plays a role in cell cycle G1/S transition. The expression of this gene peaks at the G1-S phase and exhibits a pattern of tissue specificity distinct from that of cyclin E1. A significantly increased expression level of this gene was observed in tumor-derived cells. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for disruptions in this gene are phenotypically normal. Male mice show reduced fertility but are otherwise normal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T A 13: 98,984,466 R17S probably benign Het
Abtb2 A T 2: 103,709,488 M733L probably benign Het
Acss3 G A 10: 107,084,856 P131L probably damaging Het
Adgrv1 T A 13: 81,391,767 I5678F probably benign Het
Aff1 C T 5: 103,754,720 L6F possibly damaging Het
AI314180 T G 4: 58,877,157 T93P probably damaging Het
Ank3 G T 10: 69,850,176 R273L probably damaging Het
Anks1b G A 10: 90,680,837 G898D probably damaging Het
Anxa11 C T 14: 25,872,734 P131S unknown Het
Ap4e1 T A 2: 127,047,115 M500K probably benign Het
Bag3 T C 7: 128,540,198 S138P probably damaging Het
Capn9 T C 8: 124,617,454 V670A probably benign Het
Cdh23 A T 10: 60,426,672 Y702* probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cit A T 5: 115,948,065 E896V probably damaging Het
Cntln T A 4: 85,096,761 N1096K probably damaging Het
Cntnap5c T C 17: 58,104,752 C544R probably damaging Het
Csf1 A T 3: 107,748,359 L452Q possibly damaging Het
Cts8 T A 13: 61,249,223 K294N possibly damaging Het
D430042O09Rik T C 7: 125,870,697 V1446A probably benign Het
Dcakd T G 11: 102,999,792 E56D possibly damaging Het
Dnah17 T C 11: 118,108,161 I929V probably benign Het
Dnah2 G T 11: 69,491,641 H1214Q probably benign Het
Dock9 T C 14: 121,634,594 D536G probably damaging Het
Drc3 A G 11: 60,393,770 N467S possibly damaging Het
Dysf A G 6: 84,107,136 probably null Het
Evpl A T 11: 116,230,922 L378Q probably damaging Het
Fer1l4 A T 2: 156,024,740 H1520Q probably damaging Het
Fhod1 A T 8: 105,337,148 probably benign Het
Gabra1 T A 11: 42,182,378 probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14137 A G 2: 119,175,091 T44A possibly damaging Het
Gm9833 T C 3: 10,089,179 I336T probably damaging Het
Herc2 T C 7: 56,191,265 M3444T probably benign Het
Igsf5 T C 16: 96,396,448 S208P possibly damaging Het
Ino80b A G 6: 83,125,085 L12P possibly damaging Het
Insrr A G 3: 87,812,965 D970G probably damaging Het
Iqcf4 G A 9: 106,568,675 A91V probably benign Het
Itga10 A G 3: 96,656,762 T911A probably benign Het
Klhl30 A T 1: 91,357,364 D314V probably benign Het
Lpcat1 T C 13: 73,510,955 V330A possibly damaging Het
Nhlrc3 A T 3: 53,452,523 D306E possibly damaging Het
Notum T A 11: 120,657,940 I187F probably damaging Het
Nphp3 T C 9: 104,015,441 L288P probably damaging Het
Ntrk2 G T 13: 58,871,756 E394* probably null Het
Olfr420 T A 1: 174,152,182 V222D probably benign Het
Pbld2 A G 10: 63,039,152 K63E probably benign Het
Phc2 T C 4: 128,748,189 M768T possibly damaging Het
Pik3c2g G A 6: 139,626,563 C249Y probably damaging Het
Plod1 G A 4: 147,916,315 probably benign Het
Plscr2 A T 9: 92,290,719 T9S probably benign Het
Pnrc1 T A 4: 33,246,315 M215L probably benign Het
Prcp G T 7: 92,928,633 C370F probably damaging Het
Pter A G 2: 12,978,394 N70S probably damaging Het
Ptprt G T 2: 161,553,859 H1131Q probably damaging Het
Rasal2 T C 1: 157,411,862 D8G possibly damaging Het
Rcn2 A C 9: 56,052,925 K159Q probably benign Het
Rex2 T A 4: 147,057,515 C153* probably null Het
Rps6ka2 T C 17: 7,170,367 F8S possibly damaging Het
Samd9l A G 6: 3,375,383 L626S probably damaging Het
Sptb A G 12: 76,620,654 probably null Het
Srgap3 A T 6: 112,816,610 V135D probably damaging Het
Srsf7 T C 17: 80,207,253 probably benign Het
Tacc2 A G 7: 130,626,525 T1647A probably benign Het
Thap12 G T 7: 98,703,405 A6S probably damaging Het
Tmem33 T A 5: 67,268,551 L146* probably null Het
Trip13 C A 13: 73,936,259 E36* probably null Het
Vkorc1l1 T A 5: 129,942,238 C23S probably damaging Het
Vmn1r20 G A 6: 57,432,127 R146H probably benign Het
Vmn1r222 T A 13: 23,232,795 I83F probably benign Het
Vmn2r107 A T 17: 20,355,782 I125F probably benign Het
Vmn2r116 A G 17: 23,386,762 D216G probably damaging Het
Vwa3a C T 7: 120,795,651 T898I probably benign Het
Wdfy3 T C 5: 101,968,946 D76G probably damaging Het
Wdhd1 T C 14: 47,273,122 D148G possibly damaging Het
Xylt1 T C 7: 117,656,737 I844T probably damaging Het
Zfp106 A T 2: 120,522,704 V1535D probably damaging Het
Zfp385b A T 2: 77,413,979 L315Q possibly damaging Het
Zfp458 T A 13: 67,256,806 H523L probably damaging Het
Zfp712 T C 13: 67,041,329 H378R probably damaging Het
Zic1 T C 9: 91,364,503 Y172C probably damaging Het
Other mutations in Ccne2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Ccne2 APN 4 11199322 missense probably benign 0.01
IGL02207:Ccne2 APN 4 11202261 missense probably benign 0.00
IGL02885:Ccne2 APN 4 11198723 splice site probably benign
R0367:Ccne2 UTSW 4 11201426 splice site probably benign
R0686:Ccne2 UTSW 4 11197220 missense possibly damaging 0.93
R1056:Ccne2 UTSW 4 11192707 missense probably damaging 0.99
R1068:Ccne2 UTSW 4 11192850 missense probably benign
R2076:Ccne2 UTSW 4 11197177 missense probably damaging 1.00
R2167:Ccne2 UTSW 4 11197249 missense probably benign 0.00
R2190:Ccne2 UTSW 4 11197241 missense probably benign 0.02
R3724:Ccne2 UTSW 4 11203039 missense probably benign 0.09
R3766:Ccne2 UTSW 4 11199293 splice site probably benign
R4595:Ccne2 UTSW 4 11202986 missense probably benign
R5469:Ccne2 UTSW 4 11201353 nonsense probably null
R5543:Ccne2 UTSW 4 11194026 missense probably benign 0.04
R5884:Ccne2 UTSW 4 11199411 missense probably benign 0.00
R7493:Ccne2 UTSW 4 11198772 missense probably damaging 1.00
R7553:Ccne2 UTSW 4 11201348 missense probably benign 0.02
R7591:Ccne2 UTSW 4 11201393 missense probably benign
R7801:Ccne2 UTSW 4 11194079 critical splice donor site probably null
R7996:Ccne2 UTSW 4 11201347 missense not run
Predicted Primers PCR Primer
(F):5'- CGAAATTGAGGTTTTAGTCTGAGC -3'
(R):5'- AAGGGTCAAACGTTTTCTTGTTGAC -3'

Sequencing Primer
(F):5'- GAGGTTTTAGTCTGAGCATATAGTTC -3'
(R):5'- GTTGACGATTTATCTCTGCCATTTTG -3'
Posted On2018-04-02