Mutagenetix > Incidental Mutations

Incidental Mutation 'R6298:AI314180'

508882

Institutional Source

Beutler Lab

Gene Symbol

AI314180

Ensembl Gene

ENSMUSG00000050812

Gene Name

expressed sequence AI314180

Synonyms

MMRRC Submission

Accession Numbers

Is this an essential gene?

Possibly non essential (E-score: 0.390) question?

Stock #

R6298 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

58798911-58912749 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 58877157 bp

Zygosity

Heterozygous

Amino Acid Change

Threonine to Proline at position 93 (T93P)

Ref Sequence

ENSEMBL: ENSMUSP00000117585 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000055822] [ENSMUST00000102889] [ENSMUST00000107557] [ENSMUST00000134848] [ENSMUST00000144512] [ENSMUST00000149301]

Predicted Effect

probably damaging
Transcript: ENSMUST00000055822
AA Change: T93P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000061113
Gene: ENSMUSG00000050812
AA Change: T93P

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	359	2.5e-110	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000102889
AA Change: T93P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: T93P

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	1.1e-155	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
SCOP:d1qbkb_	693	1491	3e-31	SMART
low complexity region	1781	1797	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000107557
AA Change: T93P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000103182
Gene: ENSMUSG00000050812
AA Change: T93P

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	7.6e-164	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000134848
AA Change: T97P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000114715
Gene: ENSMUSG00000050812
AA Change: T97P

Domain	Start	End	E-Value	Type
Pfam:Ecm29	14	246	1.4e-76	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000144512
AA Change: T93P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000118103
Gene: ENSMUSG00000050812
AA Change: T93P

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	2.3e-164	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000149301
AA Change: T93P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812
AA Change: T93P

Domain	Start	End	E-Value	Type
Pfam:Ecm29	10	517	4e-163	PFAM
low complexity region	627	642	N/A	INTRINSIC
low complexity region	653	665	N/A	INTRINSIC
SCOP:d1qbkb_	693	1490	8e-32	SMART

Meta Mutation Damage Score

0.4952

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

98% (79/81)

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024P04Rik	T	A	13: 98,984,466	R17S	probably benign	Het
Abtb2	A	T	2: 103,709,488	M733L	probably benign	Het
Acss3	G	A	10: 107,084,856	P131L	probably damaging	Het
Adgrv1	T	A	13: 81,391,767	I5678F	probably benign	Het
Aff1	C	T	5: 103,754,720	L6F	possibly damaging	Het
Ank3	G	T	10: 69,850,176	R273L	probably damaging	Het
Anks1b	G	A	10: 90,680,837	G898D	probably damaging	Het
Anxa11	C	T	14: 25,872,734	P131S	unknown	Het
Ap4e1	T	A	2: 127,047,115	M500K	probably benign	Het
Bag3	T	C	7: 128,540,198	S138P	probably damaging	Het
Capn9	T	C	8: 124,617,454	V670A	probably benign	Het
Ccne2	T	A	4: 11,199,306	W236R	probably damaging	Het
Cdh23	A	T	10: 60,426,672	Y702*	probably null	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cit	A	T	5: 115,948,065	E896V	probably damaging	Het
Cntln	T	A	4: 85,096,761	N1096K	probably damaging	Het
Cntnap5c	T	C	17: 58,104,752	C544R	probably damaging	Het
Csf1	A	T	3: 107,748,359	L452Q	possibly damaging	Het
Cts8	T	A	13: 61,249,223	K294N	possibly damaging	Het
D430042O09Rik	T	C	7: 125,870,697	V1446A	probably benign	Het
Dcakd	T	G	11: 102,999,792	E56D	possibly damaging	Het
Dnah17	T	C	11: 118,108,161	I929V	probably benign	Het
Dnah2	G	T	11: 69,491,641	H1214Q	probably benign	Het
Dock9	T	C	14: 121,634,594	D536G	probably damaging	Het
Drc3	A	G	11: 60,393,770	N467S	possibly damaging	Het
Dysf	A	G	6: 84,107,136		probably null	Het
Evpl	A	T	11: 116,230,922	L378Q	probably damaging	Het
Fer1l4	A	T	2: 156,024,740	H1520Q	probably damaging	Het
Fhod1	A	T	8: 105,337,148		probably benign	Het
Gabra1	T	A	11: 42,182,378		probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm14137	A	G	2: 119,175,091	T44A	possibly damaging	Het
Gm9833	T	C	3: 10,089,179	I336T	probably damaging	Het
Herc2	T	C	7: 56,191,265	M3444T	probably benign	Het
Igsf5	T	C	16: 96,396,448	S208P	possibly damaging	Het
Ino80b	A	G	6: 83,125,085	L12P	possibly damaging	Het
Insrr	A	G	3: 87,812,965	D970G	probably damaging	Het
Iqcf4	G	A	9: 106,568,675	A91V	probably benign	Het
Itga10	A	G	3: 96,656,762	T911A	probably benign	Het
Klhl30	A	T	1: 91,357,364	D314V	probably benign	Het
Lpcat1	T	C	13: 73,510,955	V330A	possibly damaging	Het
Nhlrc3	A	T	3: 53,452,523	D306E	possibly damaging	Het
Notum	T	A	11: 120,657,940	I187F	probably damaging	Het
Nphp3	T	C	9: 104,015,441	L288P	probably damaging	Het
Ntrk2	G	T	13: 58,871,756	E394*	probably null	Het
Olfr420	T	A	1: 174,152,182	V222D	probably benign	Het
Pbld2	A	G	10: 63,039,152	K63E	probably benign	Het
Phc2	T	C	4: 128,748,189	M768T	possibly damaging	Het
Pik3c2g	G	A	6: 139,626,563	C249Y	probably damaging	Het
Plod1	G	A	4: 147,916,315		probably benign	Het
Plscr2	A	T	9: 92,290,719	T9S	probably benign	Het
Pnrc1	T	A	4: 33,246,315	M215L	probably benign	Het
Prcp	G	T	7: 92,928,633	C370F	probably damaging	Het
Pter	A	G	2: 12,978,394	N70S	probably damaging	Het
Ptprt	G	T	2: 161,553,859	H1131Q	probably damaging	Het
Rasal2	T	C	1: 157,411,862	D8G	possibly damaging	Het
Rcn2	A	C	9: 56,052,925	K159Q	probably benign	Het
Rex2	T	A	4: 147,057,515	C153*	probably null	Het
Rps6ka2	T	C	17: 7,170,367	F8S	possibly damaging	Het
Samd9l	A	G	6: 3,375,383	L626S	probably damaging	Het
Sptb	A	G	12: 76,620,654		probably null	Het
Srgap3	A	T	6: 112,816,610	V135D	probably damaging	Het
Srsf7	T	C	17: 80,207,253		probably benign	Het
Tacc2	A	G	7: 130,626,525	T1647A	probably benign	Het
Thap12	G	T	7: 98,703,405	A6S	probably damaging	Het
Tmem33	T	A	5: 67,268,551	L146*	probably null	Het
Trip13	C	A	13: 73,936,259	E36*	probably null	Het
Vkorc1l1	T	A	5: 129,942,238	C23S	probably damaging	Het
Vmn1r20	G	A	6: 57,432,127	R146H	probably benign	Het
Vmn1r222	T	A	13: 23,232,795	I83F	probably benign	Het
Vmn2r107	A	T	17: 20,355,782	I125F	probably benign	Het
Vmn2r116	A	G	17: 23,386,762	D216G	probably damaging	Het
Vwa3a	C	T	7: 120,795,651	T898I	probably benign	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Wdhd1	T	C	14: 47,273,122	D148G	possibly damaging	Het
Xylt1	T	C	7: 117,656,737	I844T	probably damaging	Het
Zfp106	A	T	2: 120,522,704	V1535D	probably damaging	Het
Zfp385b	A	T	2: 77,413,979	L315Q	possibly damaging	Het
Zfp458	T	A	13: 67,256,806	H523L	probably damaging	Het
Zfp712	T	C	13: 67,041,329	H378R	probably damaging	Het
Zic1	T	C	9: 91,364,503	Y172C	probably damaging	Het

Other mutations in AI314180

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00799:AI314180	APN	4	58828047	missense	possibly damaging	0.95
IGL01145:AI314180	APN	4	58811501	missense	probably null	0.08
IGL01371:AI314180	APN	4	58809718	missense	probably damaging	1.00
IGL01445:AI314180	APN	4	58833988	missense	probably benign	0.08
IGL01452:AI314180	APN	4	58836181	missense	probably damaging	0.99
IGL01626:AI314180	APN	4	58832814	splice site	probably benign
IGL01672:AI314180	APN	4	58814041	missense	probably benign	0.40
IGL01943:AI314180	APN	4	58849937	missense	possibly damaging	0.91
IGL01944:AI314180	APN	4	58861544	missense	probably benign	0.42
IGL02190:AI314180	APN	4	58800190	missense	probably benign	0.12
IGL02272:AI314180	APN	4	58811731	missense	probably benign	0.00
IGL02435:AI314180	APN	4	58830325	splice site	probably benign
IGL02516:AI314180	APN	4	58877102	missense	probably damaging	1.00
IGL02540:AI314180	APN	4	58805534	splice site	probably benign
IGL02709:AI314180	APN	4	58872699	missense	possibly damaging	0.90
IGL02742:AI314180	APN	4	58840757	missense	probably damaging	0.96
IGL02812:AI314180	APN	4	58864343	splice site	probably benign
IGL02828:AI314180	APN	4	58875512	missense	possibly damaging	0.59
IGL03130:AI314180	APN	4	58800288	missense	probably benign
IGL03179:AI314180	APN	4	58832777	missense	probably damaging	1.00
IGL03237:AI314180	APN	4	58810668	missense	probably benign	0.40
IGL03344:AI314180	APN	4	58828538	missense	probably damaging	1.00
BB006:AI314180	UTSW	4	58869554	missense	probably damaging	1.00
BB016:AI314180	UTSW	4	58869554	missense	probably damaging	1.00
R0051:AI314180	UTSW	4	58832729	missense	probably damaging	1.00
R0051:AI314180	UTSW	4	58832729	missense	probably damaging	1.00
R0313:AI314180	UTSW	4	58811892	missense	probably benign	0.11
R0399:AI314180	UTSW	4	58827047	missense	possibly damaging	0.69
R0487:AI314180	UTSW	4	58819155	missense	probably damaging	1.00
R0492:AI314180	UTSW	4	58864418	missense	probably damaging	1.00
R0705:AI314180	UTSW	4	58885366	critical splice donor site	probably null
R0847:AI314180	UTSW	4	58841439	missense	probably benign	0.14
R1467:AI314180	UTSW	4	58832753	missense	probably benign
R1467:AI314180	UTSW	4	58832753	missense	probably benign
R1482:AI314180	UTSW	4	58820163	missense	possibly damaging	0.85
R1529:AI314180	UTSW	4	58832701	splice site	probably null
R1771:AI314180	UTSW	4	58879100	missense	probably damaging	1.00
R1776:AI314180	UTSW	4	58879100	missense	probably damaging	1.00
R1822:AI314180	UTSW	4	58805539	critical splice donor site	probably null
R1864:AI314180	UTSW	4	58849942	missense	possibly damaging	0.62
R2029:AI314180	UTSW	4	58844165	nonsense	probably null
R2061:AI314180	UTSW	4	58824270	missense	probably damaging	1.00
R2125:AI314180	UTSW	4	58833978	missense	probably benign
R2266:AI314180	UTSW	4	58830332	critical splice donor site	probably null
R2889:AI314180	UTSW	4	58836165	missense	probably benign
R2902:AI314180	UTSW	4	58809691	missense	probably benign	0.31
R2903:AI314180	UTSW	4	58828622	missense	possibly damaging	0.50
R2925:AI314180	UTSW	4	58833928	nonsense	probably null
R4151:AI314180	UTSW	4	58836254	missense	possibly damaging	0.51
R4225:AI314180	UTSW	4	58847027	missense	probably damaging	1.00
R4486:AI314180	UTSW	4	58820086	intron	probably benign
R4576:AI314180	UTSW	4	58834708	intron	probably benign
R4580:AI314180	UTSW	4	58840751	missense	probably damaging	1.00
R4654:AI314180	UTSW	4	58834523	missense	possibly damaging	0.86
R4688:AI314180	UTSW	4	58840757	missense	probably damaging	0.96
R4726:AI314180	UTSW	4	58844191	missense	probably damaging	1.00
R4825:AI314180	UTSW	4	58850911	missense	probably damaging	0.99
R4928:AI314180	UTSW	4	58827073	missense	probably damaging	1.00
R5098:AI314180	UTSW	4	58877048	missense	probably damaging	1.00
R5284:AI314180	UTSW	4	58836172	missense	possibly damaging	0.90
R5375:AI314180	UTSW	4	58809401	nonsense	probably null
R5382:AI314180	UTSW	4	58850934	missense	probably benign	0.38
R5487:AI314180	UTSW	4	58809421	missense	probably benign	0.22
R5703:AI314180	UTSW	4	58877171	splice site	probably null
R5761:AI314180	UTSW	4	58853131	missense	probably damaging	1.00
R5791:AI314180	UTSW	4	58814027	missense	possibly damaging	0.90
R5791:AI314180	UTSW	4	58822111	missense	probably damaging	1.00
R5928:AI314180	UTSW	4	58849948	missense	possibly damaging	0.59
R6062:AI314180	UTSW	4	58826453	missense	possibly damaging	0.84
R6246:AI314180	UTSW	4	58811365	splice site	probably null
R6326:AI314180	UTSW	4	58827068	missense	probably benign	0.34
R6478:AI314180	UTSW	4	58810785	missense	probably damaging	1.00
R6707:AI314180	UTSW	4	58879101	missense	possibly damaging	0.52
R6846:AI314180	UTSW	4	58814081	missense	possibly damaging	0.85
R6857:AI314180	UTSW	4	58814065	missense	probably damaging	1.00
R6951:AI314180	UTSW	4	58853114	critical splice donor site	probably null
R7088:AI314180	UTSW	4	58849766	missense	possibly damaging	0.93
R7302:AI314180	UTSW	4	58834593	missense	probably benign	0.43
R7337:AI314180	UTSW	4	58827047	missense	possibly damaging	0.69
R7341:AI314180	UTSW	4	58809415	missense	possibly damaging	0.94
R7344:AI314180	UTSW	4	58824770	missense	probably benign	0.08
R7525:AI314180	UTSW	4	58847038	missense	possibly damaging	0.84
R7530:AI314180	UTSW	4	58815317	missense	probably damaging	0.99
R7533:AI314180	UTSW	4	58809411	missense	probably benign	0.12
R7557:AI314180	UTSW	4	58849691	missense	possibly damaging	0.85
R7698:AI314180	UTSW	4	58832660	missense	unknown
R7793:AI314180	UTSW	4	58853150	missense	probably damaging	1.00
R7892:AI314180	UTSW	4	58828593	missense	probably benign
R7894:AI314180	UTSW	4	58853708	missense	probably damaging	1.00
R7929:AI314180	UTSW	4	58869554	missense	probably damaging	1.00
R8010:AI314180	UTSW	4	58832681	missense	unknown
R8082:AI314180	UTSW	4	58807852	missense	probably benign	0.00
R8175:AI314180	UTSW	4	58872756	missense	probably damaging	1.00
R8191:AI314180	UTSW	4	58872587	critical splice donor site	probably null
R8326:AI314180	UTSW	4	58847093	missense	probably damaging	1.00
R8459:AI314180	UTSW	4	58821379	missense	probably damaging	1.00
R8683:AI314180	UTSW	4	58834515	missense	probably benign	0.31
R8747:AI314180	UTSW	4	58828632	missense	probably damaging	0.98
X0060:AI314180	UTSW	4	58840752	missense	possibly damaging	0.73
Z1177:AI314180	UTSW	4	58861614	missense	probably damaging	0.99

Predicted Primers

PCR Primer
(F):5'- CTGAAAGGCAAAAGTTGTTGACTC -3'
(R):5'- GTTATTGCAGCAAACCGGGAG -3'

Sequencing Primer
(F):5'- TGTTGACTCTTACAGATGGGAAC -3'
(R):5'- CCGGGAGATCTGCTGATAATG -3'

Posted On

2018-04-02