Incidental Mutation 'R6298:AI314180'
ID508882
Institutional Source Beutler Lab
Gene Symbol AI314180
Ensembl Gene ENSMUSG00000050812
Gene Nameexpressed sequence AI314180
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.372) question?
Stock #R6298 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location58798911-58912749 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 58877157 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Proline at position 93 (T93P)
Ref Sequence ENSEMBL: ENSMUSP00000117585 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055822] [ENSMUST00000102889] [ENSMUST00000107557] [ENSMUST00000134848] [ENSMUST00000144512] [ENSMUST00000149301]
Predicted Effect probably damaging
Transcript: ENSMUST00000055822
AA Change: T93P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000061113
Gene: ENSMUSG00000050812
AA Change: T93P

DomainStartEndE-ValueType
Pfam:Ecm29 10 359 2.5e-110 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000102889
AA Change: T93P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000099953
Gene: ENSMUSG00000050812
AA Change: T93P

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 1.1e-155 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1491 3e-31 SMART
low complexity region 1781 1797 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107557
AA Change: T93P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103182
Gene: ENSMUSG00000050812
AA Change: T93P

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 7.6e-164 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000134848
AA Change: T97P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114715
Gene: ENSMUSG00000050812
AA Change: T97P

DomainStartEndE-ValueType
Pfam:Ecm29 14 246 1.4e-76 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000144512
AA Change: T93P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000118103
Gene: ENSMUSG00000050812
AA Change: T93P

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 2.3e-164 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000149301
AA Change: T93P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117585
Gene: ENSMUSG00000050812
AA Change: T93P

DomainStartEndE-ValueType
Pfam:Ecm29 10 517 4e-163 PFAM
low complexity region 627 642 N/A INTRINSIC
low complexity region 653 665 N/A INTRINSIC
SCOP:d1qbkb_ 693 1490 8e-32 SMART
Meta Mutation Damage Score 0.4952 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T A 13: 98,984,466 R17S probably benign Het
Abtb2 A T 2: 103,709,488 M733L probably benign Het
Acss3 G A 10: 107,084,856 P131L probably damaging Het
Adgrv1 T A 13: 81,391,767 I5678F probably benign Het
Aff1 C T 5: 103,754,720 L6F possibly damaging Het
Ank3 G T 10: 69,850,176 R273L probably damaging Het
Anks1b G A 10: 90,680,837 G898D probably damaging Het
Anxa11 C T 14: 25,872,734 P131S unknown Het
Ap4e1 T A 2: 127,047,115 M500K probably benign Het
Bag3 T C 7: 128,540,198 S138P probably damaging Het
Capn9 T C 8: 124,617,454 V670A probably benign Het
Ccne2 T A 4: 11,199,306 W236R probably damaging Het
Cdh23 A T 10: 60,426,672 Y702* probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cit A T 5: 115,948,065 E896V probably damaging Het
Cntln T A 4: 85,096,761 N1096K probably damaging Het
Cntnap5c T C 17: 58,104,752 C544R probably damaging Het
Csf1 A T 3: 107,748,359 L452Q possibly damaging Het
Cts8 T A 13: 61,249,223 K294N possibly damaging Het
D430042O09Rik T C 7: 125,870,697 V1446A probably benign Het
Dcakd T G 11: 102,999,792 E56D possibly damaging Het
Dnah17 T C 11: 118,108,161 I929V probably benign Het
Dnah2 G T 11: 69,491,641 H1214Q probably benign Het
Dock9 T C 14: 121,634,594 D536G probably damaging Het
Drc3 A G 11: 60,393,770 N467S possibly damaging Het
Dysf A G 6: 84,107,136 probably null Het
Evpl A T 11: 116,230,922 L378Q probably damaging Het
Fer1l4 A T 2: 156,024,740 H1520Q probably damaging Het
Fhod1 A T 8: 105,337,148 probably benign Het
Gabra1 T A 11: 42,182,378 probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14137 A G 2: 119,175,091 T44A possibly damaging Het
Gm9833 T C 3: 10,089,179 I336T probably damaging Het
Herc2 T C 7: 56,191,265 M3444T probably benign Het
Igsf5 T C 16: 96,396,448 S208P possibly damaging Het
Ino80b A G 6: 83,125,085 L12P possibly damaging Het
Insrr A G 3: 87,812,965 D970G probably damaging Het
Iqcf4 G A 9: 106,568,675 A91V probably benign Het
Itga10 A G 3: 96,656,762 T911A probably benign Het
Klhl30 A T 1: 91,357,364 D314V probably benign Het
Lpcat1 T C 13: 73,510,955 V330A possibly damaging Het
Nhlrc3 A T 3: 53,452,523 D306E possibly damaging Het
Notum T A 11: 120,657,940 I187F probably damaging Het
Nphp3 T C 9: 104,015,441 L288P probably damaging Het
Ntrk2 G T 13: 58,871,756 E394* probably null Het
Olfr420 T A 1: 174,152,182 V222D probably benign Het
Pbld2 A G 10: 63,039,152 K63E probably benign Het
Phc2 T C 4: 128,748,189 M768T possibly damaging Het
Pik3c2g G A 6: 139,626,563 C249Y probably damaging Het
Plod1 G A 4: 147,916,315 probably benign Het
Plscr2 A T 9: 92,290,719 T9S probably benign Het
Pnrc1 T A 4: 33,246,315 M215L probably benign Het
Prcp G T 7: 92,928,633 C370F probably damaging Het
Pter A G 2: 12,978,394 N70S probably damaging Het
Ptprt G T 2: 161,553,859 H1131Q probably damaging Het
Rasal2 T C 1: 157,411,862 D8G possibly damaging Het
Rcn2 A C 9: 56,052,925 K159Q probably benign Het
Rex2 T A 4: 147,057,515 C153* probably null Het
Rps6ka2 T C 17: 7,170,367 F8S possibly damaging Het
Samd9l A G 6: 3,375,383 L626S probably damaging Het
Sptb A G 12: 76,620,654 probably null Het
Srgap3 A T 6: 112,816,610 V135D probably damaging Het
Srsf7 T C 17: 80,207,253 probably benign Het
Tacc2 A G 7: 130,626,525 T1647A probably benign Het
Thap12 G T 7: 98,703,405 A6S probably damaging Het
Tmem33 T A 5: 67,268,551 L146* probably null Het
Trip13 C A 13: 73,936,259 E36* probably null Het
Vkorc1l1 T A 5: 129,942,238 C23S probably damaging Het
Vmn1r20 G A 6: 57,432,127 R146H probably benign Het
Vmn1r222 T A 13: 23,232,795 I83F probably benign Het
Vmn2r107 A T 17: 20,355,782 I125F probably benign Het
Vmn2r116 A G 17: 23,386,762 D216G probably damaging Het
Vwa3a C T 7: 120,795,651 T898I probably benign Het
Wdfy3 T C 5: 101,968,946 D76G probably damaging Het
Wdhd1 T C 14: 47,273,122 D148G possibly damaging Het
Xylt1 T C 7: 117,656,737 I844T probably damaging Het
Zfp106 A T 2: 120,522,704 V1535D probably damaging Het
Zfp385b A T 2: 77,413,979 L315Q possibly damaging Het
Zfp458 T A 13: 67,256,806 H523L probably damaging Het
Zfp712 T C 13: 67,041,329 H378R probably damaging Het
Zic1 T C 9: 91,364,503 Y172C probably damaging Het
Other mutations in AI314180
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00799:AI314180 APN 4 58828047 missense possibly damaging 0.95
IGL01145:AI314180 APN 4 58811501 missense probably null 0.08
IGL01371:AI314180 APN 4 58809718 missense probably damaging 1.00
IGL01445:AI314180 APN 4 58833988 missense probably benign 0.08
IGL01452:AI314180 APN 4 58836181 missense probably damaging 0.99
IGL01626:AI314180 APN 4 58832814 splice site probably benign
IGL01672:AI314180 APN 4 58814041 missense probably benign 0.40
IGL01943:AI314180 APN 4 58849937 missense possibly damaging 0.91
IGL01944:AI314180 APN 4 58861544 missense probably benign 0.42
IGL02190:AI314180 APN 4 58800190 missense probably benign 0.12
IGL02272:AI314180 APN 4 58811731 missense probably benign 0.00
IGL02435:AI314180 APN 4 58830325 splice site probably benign
IGL02516:AI314180 APN 4 58877102 missense probably damaging 1.00
IGL02540:AI314180 APN 4 58805534 splice site probably benign
IGL02709:AI314180 APN 4 58872699 missense possibly damaging 0.90
IGL02742:AI314180 APN 4 58840757 missense probably damaging 0.96
IGL02812:AI314180 APN 4 58864343 splice site probably benign
IGL02828:AI314180 APN 4 58875512 missense possibly damaging 0.59
IGL03130:AI314180 APN 4 58800288 missense probably benign
IGL03179:AI314180 APN 4 58832777 missense probably damaging 1.00
IGL03237:AI314180 APN 4 58810668 missense probably benign 0.40
IGL03344:AI314180 APN 4 58828538 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0051:AI314180 UTSW 4 58832729 missense probably damaging 1.00
R0313:AI314180 UTSW 4 58811892 missense probably benign 0.11
R0399:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R0487:AI314180 UTSW 4 58819155 missense probably damaging 1.00
R0492:AI314180 UTSW 4 58864418 missense probably damaging 1.00
R0705:AI314180 UTSW 4 58885366 critical splice donor site probably null
R0847:AI314180 UTSW 4 58841439 missense probably benign 0.14
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1467:AI314180 UTSW 4 58832753 missense probably benign
R1482:AI314180 UTSW 4 58820163 missense possibly damaging 0.85
R1529:AI314180 UTSW 4 58832701 splice site probably null
R1771:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1776:AI314180 UTSW 4 58879100 missense probably damaging 1.00
R1822:AI314180 UTSW 4 58805539 critical splice donor site probably null
R1864:AI314180 UTSW 4 58849942 missense possibly damaging 0.62
R2029:AI314180 UTSW 4 58844165 nonsense probably null
R2061:AI314180 UTSW 4 58824270 missense probably damaging 1.00
R2125:AI314180 UTSW 4 58833978 missense probably benign
R2266:AI314180 UTSW 4 58830332 critical splice donor site probably null
R2889:AI314180 UTSW 4 58836165 missense probably benign
R2902:AI314180 UTSW 4 58809691 missense probably benign 0.31
R2903:AI314180 UTSW 4 58828622 missense possibly damaging 0.50
R2925:AI314180 UTSW 4 58833928 nonsense probably null
R4151:AI314180 UTSW 4 58836254 missense possibly damaging 0.51
R4225:AI314180 UTSW 4 58847027 missense probably damaging 1.00
R4486:AI314180 UTSW 4 58820086 intron probably benign
R4576:AI314180 UTSW 4 58834708 intron probably benign
R4580:AI314180 UTSW 4 58840751 missense probably damaging 1.00
R4654:AI314180 UTSW 4 58834523 missense possibly damaging 0.86
R4688:AI314180 UTSW 4 58840757 missense probably damaging 0.96
R4726:AI314180 UTSW 4 58844191 missense probably damaging 1.00
R4825:AI314180 UTSW 4 58850911 missense probably damaging 0.99
R4928:AI314180 UTSW 4 58827073 missense probably damaging 1.00
R5098:AI314180 UTSW 4 58877048 missense probably damaging 1.00
R5284:AI314180 UTSW 4 58836172 missense possibly damaging 0.90
R5375:AI314180 UTSW 4 58809401 nonsense probably null
R5382:AI314180 UTSW 4 58850934 missense probably benign 0.38
R5487:AI314180 UTSW 4 58809421 missense probably benign 0.22
R5703:AI314180 UTSW 4 58877171 splice site probably null
R5761:AI314180 UTSW 4 58853131 missense probably damaging 1.00
R5791:AI314180 UTSW 4 58814027 missense possibly damaging 0.90
R5791:AI314180 UTSW 4 58822111 missense probably damaging 1.00
R5928:AI314180 UTSW 4 58849948 missense possibly damaging 0.59
R6062:AI314180 UTSW 4 58826453 missense possibly damaging 0.84
R6246:AI314180 UTSW 4 58811365 splice site probably null
R6326:AI314180 UTSW 4 58827068 missense probably benign 0.34
R6478:AI314180 UTSW 4 58810785 missense probably damaging 1.00
R6707:AI314180 UTSW 4 58879101 missense possibly damaging 0.52
R6846:AI314180 UTSW 4 58814081 missense possibly damaging 0.85
R6857:AI314180 UTSW 4 58814065 missense probably damaging 1.00
R6951:AI314180 UTSW 4 58853114 critical splice donor site probably null
R7088:AI314180 UTSW 4 58849766 missense possibly damaging 0.93
R7302:AI314180 UTSW 4 58834593 missense probably benign 0.43
R7337:AI314180 UTSW 4 58827047 missense possibly damaging 0.69
R7341:AI314180 UTSW 4 58809415 missense possibly damaging 0.94
R7344:AI314180 UTSW 4 58824770 missense probably benign 0.08
R7525:AI314180 UTSW 4 58847038 missense possibly damaging 0.84
R7530:AI314180 UTSW 4 58815317 missense probably damaging 0.99
R7533:AI314180 UTSW 4 58809411 missense probably benign 0.12
R7557:AI314180 UTSW 4 58849691 missense possibly damaging 0.85
R7698:AI314180 UTSW 4 58832660 missense unknown
R7793:AI314180 UTSW 4 58853150 missense probably damaging 1.00
R7892:AI314180 UTSW 4 58828593 missense probably benign
R7894:AI314180 UTSW 4 58853708 missense probably damaging 1.00
R7975:AI314180 UTSW 4 58828593 missense probably benign
R7977:AI314180 UTSW 4 58853708 missense probably damaging 1.00
X0060:AI314180 UTSW 4 58840752 missense possibly damaging 0.73
Predicted Primers PCR Primer
(F):5'- CTGAAAGGCAAAAGTTGTTGACTC -3'
(R):5'- GTTATTGCAGCAAACCGGGAG -3'

Sequencing Primer
(F):5'- TGTTGACTCTTACAGATGGGAAC -3'
(R):5'- CCGGGAGATCTGCTGATAATG -3'
Posted On2018-04-02