Incidental Mutation 'R6298:Tmem33'
ID508887
Institutional Source Beutler Lab
Gene Symbol Tmem33
Ensembl Gene ENSMUSG00000037720
Gene Nametransmembrane protein 33
Synonyms2700052H22Rik, 5430406L04Rik, 1110006G02Rik, 1600019D15Rik, 2410089A21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.208) question?
Stock #R6298 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location67260565-67291461 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 67268551 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 146 (L146*)
Ref Sequence ENSEMBL: ENSMUSP00000124390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037918] [ENSMUST00000160352] [ENSMUST00000161233] [ENSMUST00000161369] [ENSMUST00000162074] [ENSMUST00000162543] [ENSMUST00000201979]
Predicted Effect probably null
Transcript: ENSMUST00000037918
AA Change: L146*
SMART Domains Protein: ENSMUSP00000042852
Gene: ENSMUSG00000037720
AA Change: L146*

DomainStartEndE-ValueType
Pfam:UPF0121 1 247 9.8e-126 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000160352
AA Change: L146*
SMART Domains Protein: ENSMUSP00000124766
Gene: ENSMUSG00000037720
AA Change: L146*

DomainStartEndE-ValueType
Pfam:UPF0121 1 246 2.8e-126 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000161233
AA Change: L37*
Predicted Effect probably null
Transcript: ENSMUST00000161369
AA Change: L146*
SMART Domains Protein: ENSMUSP00000124390
Gene: ENSMUSG00000037720
AA Change: L146*

DomainStartEndE-ValueType
Pfam:UPF0121 7 245 1.8e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000162074
Predicted Effect probably benign
Transcript: ENSMUST00000162543
SMART Domains Protein: ENSMUSP00000124765
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 1 119 2.1e-53 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000163028
Predicted Effect probably benign
Transcript: ENSMUST00000201979
SMART Domains Protein: ENSMUSP00000144531
Gene: ENSMUSG00000037720

DomainStartEndE-ValueType
Pfam:UPF0121 7 61 5.9e-7 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (79/81)
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T A 13: 98,984,466 R17S probably benign Het
Abtb2 A T 2: 103,709,488 M733L probably benign Het
Acss3 G A 10: 107,084,856 P131L probably damaging Het
Adgrv1 T A 13: 81,391,767 I5678F probably benign Het
Aff1 C T 5: 103,754,720 L6F possibly damaging Het
AI314180 T G 4: 58,877,157 T93P probably damaging Het
Ank3 G T 10: 69,850,176 R273L probably damaging Het
Anks1b G A 10: 90,680,837 G898D probably damaging Het
Anxa11 C T 14: 25,872,734 P131S unknown Het
Ap4e1 T A 2: 127,047,115 M500K probably benign Het
Bag3 T C 7: 128,540,198 S138P probably damaging Het
Capn9 T C 8: 124,617,454 V670A probably benign Het
Ccne2 T A 4: 11,199,306 W236R probably damaging Het
Cdh23 A T 10: 60,426,672 Y702* probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cit A T 5: 115,948,065 E896V probably damaging Het
Cntln T A 4: 85,096,761 N1096K probably damaging Het
Cntnap5c T C 17: 58,104,752 C544R probably damaging Het
Csf1 A T 3: 107,748,359 L452Q possibly damaging Het
Cts8 T A 13: 61,249,223 K294N possibly damaging Het
D430042O09Rik T C 7: 125,870,697 V1446A probably benign Het
Dcakd T G 11: 102,999,792 E56D possibly damaging Het
Dnah17 T C 11: 118,108,161 I929V probably benign Het
Dnah2 G T 11: 69,491,641 H1214Q probably benign Het
Dock9 T C 14: 121,634,594 D536G probably damaging Het
Drc3 A G 11: 60,393,770 N467S possibly damaging Het
Dysf A G 6: 84,107,136 probably null Het
Evpl A T 11: 116,230,922 L378Q probably damaging Het
Fer1l4 A T 2: 156,024,740 H1520Q probably damaging Het
Fhod1 A T 8: 105,337,148 probably benign Het
Gabra1 T A 11: 42,182,378 probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14137 A G 2: 119,175,091 T44A possibly damaging Het
Gm9833 T C 3: 10,089,179 I336T probably damaging Het
Herc2 T C 7: 56,191,265 M3444T probably benign Het
Igsf5 T C 16: 96,396,448 S208P possibly damaging Het
Ino80b A G 6: 83,125,085 L12P possibly damaging Het
Insrr A G 3: 87,812,965 D970G probably damaging Het
Iqcf4 G A 9: 106,568,675 A91V probably benign Het
Itga10 A G 3: 96,656,762 T911A probably benign Het
Klhl30 A T 1: 91,357,364 D314V probably benign Het
Lpcat1 T C 13: 73,510,955 V330A possibly damaging Het
Nhlrc3 A T 3: 53,452,523 D306E possibly damaging Het
Notum T A 11: 120,657,940 I187F probably damaging Het
Nphp3 T C 9: 104,015,441 L288P probably damaging Het
Ntrk2 G T 13: 58,871,756 E394* probably null Het
Olfr420 T A 1: 174,152,182 V222D probably benign Het
Pbld2 A G 10: 63,039,152 K63E probably benign Het
Phc2 T C 4: 128,748,189 M768T possibly damaging Het
Pik3c2g G A 6: 139,626,563 C249Y probably damaging Het
Plod1 G A 4: 147,916,315 probably benign Het
Plscr2 A T 9: 92,290,719 T9S probably benign Het
Pnrc1 T A 4: 33,246,315 M215L probably benign Het
Prcp G T 7: 92,928,633 C370F probably damaging Het
Pter A G 2: 12,978,394 N70S probably damaging Het
Ptprt G T 2: 161,553,859 H1131Q probably damaging Het
Rasal2 T C 1: 157,411,862 D8G possibly damaging Het
Rcn2 A C 9: 56,052,925 K159Q probably benign Het
Rex2 T A 4: 147,057,515 C153* probably null Het
Rps6ka2 T C 17: 7,170,367 F8S possibly damaging Het
Samd9l A G 6: 3,375,383 L626S probably damaging Het
Sptb A G 12: 76,620,654 probably null Het
Srgap3 A T 6: 112,816,610 V135D probably damaging Het
Srsf7 T C 17: 80,207,253 probably benign Het
Tacc2 A G 7: 130,626,525 T1647A probably benign Het
Thap12 G T 7: 98,703,405 A6S probably damaging Het
Trip13 C A 13: 73,936,259 E36* probably null Het
Vkorc1l1 T A 5: 129,942,238 C23S probably damaging Het
Vmn1r20 G A 6: 57,432,127 R146H probably benign Het
Vmn1r222 T A 13: 23,232,795 I83F probably benign Het
Vmn2r107 A T 17: 20,355,782 I125F probably benign Het
Vmn2r116 A G 17: 23,386,762 D216G probably damaging Het
Vwa3a C T 7: 120,795,651 T898I probably benign Het
Wdfy3 T C 5: 101,968,946 D76G probably damaging Het
Wdhd1 T C 14: 47,273,122 D148G possibly damaging Het
Xylt1 T C 7: 117,656,737 I844T probably damaging Het
Zfp106 A T 2: 120,522,704 V1535D probably damaging Het
Zfp385b A T 2: 77,413,979 L315Q possibly damaging Het
Zfp458 T A 13: 67,256,806 H523L probably damaging Het
Zfp712 T C 13: 67,041,329 H378R probably damaging Het
Zic1 T C 9: 91,364,503 Y172C probably damaging Het
Other mutations in Tmem33
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00499:Tmem33 APN 5 67284195 missense probably damaging 1.00
IGL02076:Tmem33 APN 5 67286103 missense probably damaging 1.00
IGL03106:Tmem33 APN 5 67263796 missense probably damaging 1.00
commonplace UTSW 5 67264459 critical splice donor site probably null
R0573:Tmem33 UTSW 5 67264260 intron probably benign
R0839:Tmem33 UTSW 5 67264308 missense probably damaging 1.00
R1129:Tmem33 UTSW 5 67264460 splice site probably null
R1438:Tmem33 UTSW 5 67267291 splice site probably null
R1692:Tmem33 UTSW 5 67268554 missense probably null 0.57
R4513:Tmem33 UTSW 5 67286125 missense probably benign 0.02
R4763:Tmem33 UTSW 5 67286136 missense probably benign 0.22
R6673:Tmem33 UTSW 5 67286125 missense probably benign 0.02
R6813:Tmem33 UTSW 5 67264459 critical splice donor site probably null
R7186:Tmem33 UTSW 5 67263787 missense possibly damaging 0.68
R7378:Tmem33 UTSW 5 67286133 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCTGTCAAGGGTGCTACTGATAG -3'
(R):5'- AAAGTATGATATCTGTGCGGGC -3'

Sequencing Primer
(F):5'- GACAACGGCACAGCTTTTG -3'
(R):5'- GCGGGCATCTTTATGTTCAC -3'
Posted On2018-04-02