Incidental Mutation 'R6298:Wdfy3'
ID508888
Institutional Source Beutler Lab
Gene Symbol Wdfy3
Ensembl Gene ENSMUSG00000043940
Gene NameWD repeat and FYVE domain containing 3
SynonymsD5Ertd66e, Bwf1, Bchs, 2610509D04Rik, Ggtb3
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.920) question?
Stock #R6298 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location101832956-102069921 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 101968946 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 76 (D76G)
Ref Sequence ENSEMBL: ENSMUSP00000134541 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053177] [ENSMUST00000174598] [ENSMUST00000174698] [ENSMUST00000212024]
Predicted Effect probably damaging
Transcript: ENSMUST00000053177
AA Change: D76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000052607
Gene: ENSMUSG00000043940
AA Change: D76G

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
low complexity region 1408 1417 N/A INTRINSIC
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2517 2638 3.1e-17 PFAM
Beach 2677 2958 2.54e-217 SMART
WD40 3054 3088 1.28e1 SMART
WD40 3098 3137 7.73e-6 SMART
WD40 3140 3178 8.29e-1 SMART
WD40 3183 3227 3.09e-1 SMART
low complexity region 3253 3274 N/A INTRINSIC
low complexity region 3307 3318 N/A INTRINSIC
WD40 3381 3420 1.33e1 SMART
FYVE 3428 3497 3.18e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174598
AA Change: D76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134244
Gene: ENSMUSG00000043940
AA Change: D76G

DomainStartEndE-ValueType
low complexity region 463 481 N/A INTRINSIC
Pfam:DUF4704 1392 1597 6.6e-11 PFAM
low complexity region 1629 1644 N/A INTRINSIC
Pfam:PH_BEACH 2588 2656 1.8e-14 PFAM
Beach 2695 2976 2.54e-217 SMART
WD40 3072 3106 1.28e1 SMART
WD40 3116 3155 7.73e-6 SMART
WD40 3158 3196 8.29e-1 SMART
WD40 3201 3245 3.09e-1 SMART
low complexity region 3271 3292 N/A INTRINSIC
low complexity region 3325 3336 N/A INTRINSIC
WD40 3399 3438 1.33e1 SMART
FYVE 3446 3515 3.18e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000174698
AA Change: D76G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134541
Gene: ENSMUSG00000043940
AA Change: D76G

DomainStartEndE-ValueType
Blast:WD40 235 281 2e-21 BLAST
low complexity region 463 481 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212024
AA Change: D76G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.7285 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a phosphatidylinositol 3-phosphate-binding protein that functions as a master conductor for aggregate clearance by autophagy. This protein shuttles from the nuclear membrane to colocalize with aggregated proteins, where it complexes with other autophagic components to achieve macroautophagy-mediated clearance of these aggregated proteins. However, it is not necessary for starvation-induced macroautophagy. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for hypomorphic mutations of this gene exhibit perinatal lethality, altered neural progenitor divisions and neuronal migration, a regionally enlarged cerebral cortex, and focal cortical dysplasias. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T A 13: 98,984,466 R17S probably benign Het
Abtb2 A T 2: 103,709,488 M733L probably benign Het
Acss3 G A 10: 107,084,856 P131L probably damaging Het
Adgrv1 T A 13: 81,391,767 I5678F probably benign Het
Aff1 C T 5: 103,754,720 L6F possibly damaging Het
AI314180 T G 4: 58,877,157 T93P probably damaging Het
Ank3 G T 10: 69,850,176 R273L probably damaging Het
Anks1b G A 10: 90,680,837 G898D probably damaging Het
Anxa11 C T 14: 25,872,734 P131S unknown Het
Ap4e1 T A 2: 127,047,115 M500K probably benign Het
Bag3 T C 7: 128,540,198 S138P probably damaging Het
Capn9 T C 8: 124,617,454 V670A probably benign Het
Ccne2 T A 4: 11,199,306 W236R probably damaging Het
Cdh23 A T 10: 60,426,672 Y702* probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cit A T 5: 115,948,065 E896V probably damaging Het
Cntln T A 4: 85,096,761 N1096K probably damaging Het
Cntnap5c T C 17: 58,104,752 C544R probably damaging Het
Csf1 A T 3: 107,748,359 L452Q possibly damaging Het
Cts8 T A 13: 61,249,223 K294N possibly damaging Het
D430042O09Rik T C 7: 125,870,697 V1446A probably benign Het
Dcakd T G 11: 102,999,792 E56D possibly damaging Het
Dnah17 T C 11: 118,108,161 I929V probably benign Het
Dnah2 G T 11: 69,491,641 H1214Q probably benign Het
Dock9 T C 14: 121,634,594 D536G probably damaging Het
Drc3 A G 11: 60,393,770 N467S possibly damaging Het
Dysf A G 6: 84,107,136 probably null Het
Evpl A T 11: 116,230,922 L378Q probably damaging Het
Fer1l4 A T 2: 156,024,740 H1520Q probably damaging Het
Fhod1 A T 8: 105,337,148 probably benign Het
Gabra1 T A 11: 42,182,378 probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14137 A G 2: 119,175,091 T44A possibly damaging Het
Gm9833 T C 3: 10,089,179 I336T probably damaging Het
Herc2 T C 7: 56,191,265 M3444T probably benign Het
Igsf5 T C 16: 96,396,448 S208P possibly damaging Het
Ino80b A G 6: 83,125,085 L12P possibly damaging Het
Insrr A G 3: 87,812,965 D970G probably damaging Het
Iqcf4 G A 9: 106,568,675 A91V probably benign Het
Itga10 A G 3: 96,656,762 T911A probably benign Het
Klhl30 A T 1: 91,357,364 D314V probably benign Het
Lpcat1 T C 13: 73,510,955 V330A possibly damaging Het
Nhlrc3 A T 3: 53,452,523 D306E possibly damaging Het
Notum T A 11: 120,657,940 I187F probably damaging Het
Nphp3 T C 9: 104,015,441 L288P probably damaging Het
Ntrk2 G T 13: 58,871,756 E394* probably null Het
Olfr420 T A 1: 174,152,182 V222D probably benign Het
Pbld2 A G 10: 63,039,152 K63E probably benign Het
Phc2 T C 4: 128,748,189 M768T possibly damaging Het
Pik3c2g G A 6: 139,626,563 C249Y probably damaging Het
Plod1 G A 4: 147,916,315 probably benign Het
Plscr2 A T 9: 92,290,719 T9S probably benign Het
Pnrc1 T A 4: 33,246,315 M215L probably benign Het
Prcp G T 7: 92,928,633 C370F probably damaging Het
Pter A G 2: 12,978,394 N70S probably damaging Het
Ptprt G T 2: 161,553,859 H1131Q probably damaging Het
Rasal2 T C 1: 157,411,862 D8G possibly damaging Het
Rcn2 A C 9: 56,052,925 K159Q probably benign Het
Rex2 T A 4: 147,057,515 C153* probably null Het
Rps6ka2 T C 17: 7,170,367 F8S possibly damaging Het
Samd9l A G 6: 3,375,383 L626S probably damaging Het
Sptb A G 12: 76,620,654 probably null Het
Srgap3 A T 6: 112,816,610 V135D probably damaging Het
Srsf7 T C 17: 80,207,253 probably benign Het
Tacc2 A G 7: 130,626,525 T1647A probably benign Het
Thap12 G T 7: 98,703,405 A6S probably damaging Het
Tmem33 T A 5: 67,268,551 L146* probably null Het
Trip13 C A 13: 73,936,259 E36* probably null Het
Vkorc1l1 T A 5: 129,942,238 C23S probably damaging Het
Vmn1r20 G A 6: 57,432,127 R146H probably benign Het
Vmn1r222 T A 13: 23,232,795 I83F probably benign Het
Vmn2r107 A T 17: 20,355,782 I125F probably benign Het
Vmn2r116 A G 17: 23,386,762 D216G probably damaging Het
Vwa3a C T 7: 120,795,651 T898I probably benign Het
Wdhd1 T C 14: 47,273,122 D148G possibly damaging Het
Xylt1 T C 7: 117,656,737 I844T probably damaging Het
Zfp106 A T 2: 120,522,704 V1535D probably damaging Het
Zfp385b A T 2: 77,413,979 L315Q possibly damaging Het
Zfp458 T A 13: 67,256,806 H523L probably damaging Het
Zfp712 T C 13: 67,041,329 H378R probably damaging Het
Zic1 T C 9: 91,364,503 Y172C probably damaging Het
Other mutations in Wdfy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Wdfy3 APN 5 101915338 critical splice donor site probably null
IGL00567:Wdfy3 APN 5 101912030 splice site probably benign
IGL01288:Wdfy3 APN 5 101901991 splice site probably null
IGL01323:Wdfy3 APN 5 101895064 missense probably damaging 1.00
IGL01352:Wdfy3 APN 5 101944120 missense probably damaging 1.00
IGL01553:Wdfy3 APN 5 101900031 missense probably benign
IGL01560:Wdfy3 APN 5 101957486 nonsense probably null
IGL01566:Wdfy3 APN 5 101896588 splice site probably benign
IGL01616:Wdfy3 APN 5 101913260 missense probably damaging 0.97
IGL01630:Wdfy3 APN 5 101907488 missense probably benign
IGL01791:Wdfy3 APN 5 101937412 missense probably damaging 1.00
IGL01820:Wdfy3 APN 5 101924081 missense probably benign 0.11
IGL01953:Wdfy3 APN 5 101895028 nonsense probably null
IGL02121:Wdfy3 APN 5 101898510 missense possibly damaging 0.85
IGL02167:Wdfy3 APN 5 101961157 missense probably damaging 0.98
IGL02321:Wdfy3 APN 5 101922609 missense probably damaging 0.99
IGL02327:Wdfy3 APN 5 101888192 missense probably damaging 1.00
IGL02651:Wdfy3 APN 5 101896475 missense probably benign 0.37
IGL02801:Wdfy3 APN 5 101907587 missense probably damaging 1.00
IGL02839:Wdfy3 APN 5 101968920 missense probably damaging 1.00
IGL02870:Wdfy3 APN 5 101855471 missense probably damaging 1.00
IGL02997:Wdfy3 APN 5 101894912 missense probably null 1.00
IGL03064:Wdfy3 APN 5 101935997 missense probably damaging 0.99
IGL03090:Wdfy3 APN 5 101866276 missense probably damaging 1.00
IGL03211:Wdfy3 APN 5 101844912 splice site probably benign
IGL03237:Wdfy3 APN 5 101844599 missense probably damaging 1.00
IGL03264:Wdfy3 APN 5 101900150 missense probably damaging 1.00
Esurient UTSW 5 101944103 missense probably damaging 1.00
IGL02988:Wdfy3 UTSW 5 101929981 missense probably damaging 0.99
PIT4382001:Wdfy3 UTSW 5 101882961 frame shift probably null
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0010:Wdfy3 UTSW 5 101848349 missense probably damaging 1.00
R0025:Wdfy3 UTSW 5 101845046 missense probably damaging 0.98
R0031:Wdfy3 UTSW 5 101889295 missense probably damaging 0.97
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0047:Wdfy3 UTSW 5 101944033 missense probably damaging 1.00
R0053:Wdfy3 UTSW 5 101844614 missense probably damaging 0.97
R0078:Wdfy3 UTSW 5 101888105 missense possibly damaging 0.57
R0147:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0148:Wdfy3 UTSW 5 101917411 missense probably benign 0.05
R0279:Wdfy3 UTSW 5 101868092 missense probably damaging 1.00
R0380:Wdfy3 UTSW 5 101948966 missense probably damaging 0.99
R0472:Wdfy3 UTSW 5 101957443 missense probably benign 0.13
R0513:Wdfy3 UTSW 5 101890789 missense probably damaging 0.96
R0594:Wdfy3 UTSW 5 101906185 missense possibly damaging 0.94
R0601:Wdfy3 UTSW 5 101836172 missense probably benign
R0787:Wdfy3 UTSW 5 101957388 missense probably damaging 1.00
R0825:Wdfy3 UTSW 5 101870051 missense probably damaging 1.00
R1122:Wdfy3 UTSW 5 101882966 missense possibly damaging 0.94
R1167:Wdfy3 UTSW 5 101875931 missense probably benign
R1350:Wdfy3 UTSW 5 101898552 missense probably damaging 1.00
R1422:Wdfy3 UTSW 5 101884214 splice site probably benign
R1446:Wdfy3 UTSW 5 101851310 missense possibly damaging 0.68
R1452:Wdfy3 UTSW 5 101937738 missense possibly damaging 0.91
R1457:Wdfy3 UTSW 5 101917579 missense possibly damaging 0.57
R1543:Wdfy3 UTSW 5 101844081 missense probably benign
R1633:Wdfy3 UTSW 5 101981548 missense probably damaging 1.00
R1643:Wdfy3 UTSW 5 101875915 missense possibly damaging 0.62
R1656:Wdfy3 UTSW 5 101941447 missense probably damaging 1.00
R1720:Wdfy3 UTSW 5 101926525 frame shift probably null
R1743:Wdfy3 UTSW 5 101844065 missense probably benign 0.12
R1745:Wdfy3 UTSW 5 101948929 missense probably damaging 0.96
R1850:Wdfy3 UTSW 5 101894999 missense probably damaging 1.00
R1852:Wdfy3 UTSW 5 101915376 missense probably benign 0.00
R1854:Wdfy3 UTSW 5 101888186 missense probably benign 0.05
R1880:Wdfy3 UTSW 5 101917435 missense probably benign 0.05
R1930:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1931:Wdfy3 UTSW 5 101941492 missense probably damaging 1.00
R1956:Wdfy3 UTSW 5 101919409 missense probably benign 0.30
R1965:Wdfy3 UTSW 5 101951312 missense probably damaging 1.00
R1997:Wdfy3 UTSW 5 101968946 missense probably damaging 1.00
R2015:Wdfy3 UTSW 5 101860486 missense probably null 1.00
R2087:Wdfy3 UTSW 5 101895060 missense probably damaging 1.00
R2156:Wdfy3 UTSW 5 101898425 critical splice donor site probably null
R2192:Wdfy3 UTSW 5 101907542 missense possibly damaging 0.55
R2313:Wdfy3 UTSW 5 101889284 missense probably damaging 1.00
R2332:Wdfy3 UTSW 5 101888323 splice site probably benign
R2406:Wdfy3 UTSW 5 101888259 missense probably damaging 1.00
R2679:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R2857:Wdfy3 UTSW 5 101875930 missense probably benign 0.04
R2937:Wdfy3 UTSW 5 101944122 missense probably benign 0.07
R3765:Wdfy3 UTSW 5 101861400 missense probably damaging 1.00
R3795:Wdfy3 UTSW 5 101937600 missense probably damaging 1.00
R3937:Wdfy3 UTSW 5 101944239 nonsense probably null
R3947:Wdfy3 UTSW 5 101870036 missense probably damaging 1.00
R4024:Wdfy3 UTSW 5 101924095 splice site probably benign
R4065:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4066:Wdfy3 UTSW 5 101922447 missense probably benign 0.08
R4110:Wdfy3 UTSW 5 101900058 critical splice donor site probably null
R4235:Wdfy3 UTSW 5 101922634 critical splice acceptor site probably null
R4420:Wdfy3 UTSW 5 101910984 missense probably damaging 0.97
R4620:Wdfy3 UTSW 5 101906145 missense probably damaging 0.99
R4624:Wdfy3 UTSW 5 101884083 missense possibly damaging 0.52
R4626:Wdfy3 UTSW 5 101943934 missense probably damaging 1.00
R4727:Wdfy3 UTSW 5 101930028 missense probably damaging 0.99
R4794:Wdfy3 UTSW 5 101943943 missense probably damaging 1.00
R4869:Wdfy3 UTSW 5 101894921 missense probably damaging 0.98
R4971:Wdfy3 UTSW 5 101948972 nonsense probably null
R4973:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4976:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4984:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R4986:Wdfy3 UTSW 5 101943119 missense probably benign 0.00
R5068:Wdfy3 UTSW 5 101894937 missense probably benign 0.15
R5105:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R5120:Wdfy3 UTSW 5 101868106 missense possibly damaging 0.85
R5134:Wdfy3 UTSW 5 101944103 missense probably damaging 1.00
R5139:Wdfy3 UTSW 5 101849267 critical splice donor site probably null
R5235:Wdfy3 UTSW 5 101847106 missense probably null 0.03
R5303:Wdfy3 UTSW 5 101952983 missense probably damaging 1.00
R5368:Wdfy3 UTSW 5 101872858 missense probably damaging 1.00
R5426:Wdfy3 UTSW 5 101919446 missense probably damaging 0.97
R5442:Wdfy3 UTSW 5 101896559 missense probably benign 0.04
R5487:Wdfy3 UTSW 5 101836274 missense probably damaging 1.00
R5509:Wdfy3 UTSW 5 101861448 missense possibly damaging 0.69
R5877:Wdfy3 UTSW 5 101869989 missense probably damaging 1.00
R5988:Wdfy3 UTSW 5 101884138 missense probably benign 0.00
R6017:Wdfy3 UTSW 5 101851359 missense probably benign 0.01
R6019:Wdfy3 UTSW 5 101849423 missense probably damaging 1.00
R6199:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6228:Wdfy3 UTSW 5 101898429 missense possibly damaging 0.67
R6258:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6259:Wdfy3 UTSW 5 101872965 missense possibly damaging 0.93
R6479:Wdfy3 UTSW 5 101913179 missense probably damaging 1.00
R6550:Wdfy3 UTSW 5 101953166 missense probably benign 0.19
R6776:Wdfy3 UTSW 5 101884045 missense possibly damaging 0.57
R6793:Wdfy3 UTSW 5 101917431 nonsense probably null
R6809:Wdfy3 UTSW 5 101923947 missense possibly damaging 0.63
R6836:Wdfy3 UTSW 5 101952999 missense probably damaging 1.00
R6897:Wdfy3 UTSW 5 101844066 missense probably benign 0.10
R7014:Wdfy3 UTSW 5 101894909 critical splice donor site probably null
R7034:Wdfy3 UTSW 5 101907518 missense probably damaging 1.00
R7035:Wdfy3 UTSW 5 101855549 missense probably damaging 1.00
R7135:Wdfy3 UTSW 5 101915437 missense probably damaging 1.00
R7182:Wdfy3 UTSW 5 101943892 missense possibly damaging 0.51
R7217:Wdfy3 UTSW 5 101901919 missense probably damaging 1.00
R7236:Wdfy3 UTSW 5 101836208 missense probably damaging 0.99
R7264:Wdfy3 UTSW 5 101855523 missense probably benign 0.02
R7418:Wdfy3 UTSW 5 101957500 missense probably benign 0.08
R7533:Wdfy3 UTSW 5 101882488 missense probably benign 0.27
R7543:Wdfy3 UTSW 5 101936059 missense probably benign 0.00
R7788:Wdfy3 UTSW 5 101848357 missense probably damaging 0.99
R7810:Wdfy3 UTSW 5 101895074 missense probably benign 0.01
R7810:Wdfy3 UTSW 5 101951399 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACAGTCAGTCATCTATGTGGAC -3'
(R):5'- CCAGAGGAAATGTCACTGCAC -3'

Sequencing Primer
(F):5'- TCAGTCATCTATGTGGACAGAGAAAG -3'
(R):5'- GGAAATGTCACTGCACTCATG -3'
Posted On2018-04-02