Mutagenetix > Incidental Mutation

Incidental Mutation 'R6298:Samd9l'

508891

Institutional Source

Beutler Lab

Gene Symbol

Samd9l

Ensembl Gene

ENSMUSG00000047735

Gene Name

sterile alpha motif domain containing 9-like

Synonyms

ESTM25

MMRRC Submission

044408-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R6298 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

3372257-3399572 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 3375383 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Serine at position 626 (L626S)

Ref Sequence

ENSEMBL: ENSMUSP00000112688 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000120087] [ENSMUST00000201638]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000120087
AA Change: L626S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000112688
Gene: ENSMUSG00000047735
AA Change: L626S

Domain	Start	End	E-Value	Type
SCOP:d1kw4a_	8	75	4e-8	SMART
Blast:SAM	11	75	1e-30	BLAST
low complexity region	96	115	N/A	INTRINSIC
low complexity region	385	397	N/A	INTRINSIC
low complexity region	530	541	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000201638

SMART Domains

Protein: ENSMUSP00000144632
Gene: ENSMUSG00000047735

Domain	Start	End	E-Value	Type
Pfam:Ste50p-SAM	10	80	1.2e-8	PFAM
Pfam:SAM_2	11	68	8.7e-6	PFAM
Pfam:SAM_1	12	71	2.5e-7	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.5%
20x: 98.5%

Validation Efficiency

98% (79/81)

MGI Phenotype

PHENOTYPE: Mice that are either heterozygous or homozygous for a reporter allele develop myeloid diseases and acute myelogenous leukemia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 81 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700024P04Rik	T	A	13: 98,984,466	R17S	probably benign	Het
Abtb2	A	T	2: 103,709,488	M733L	probably benign	Het
Acss3	G	A	10: 107,084,856	P131L	probably damaging	Het
Adgrv1	T	A	13: 81,391,767	I5678F	probably benign	Het
Aff1	C	T	5: 103,754,720	L6F	possibly damaging	Het
AI314180	T	G	4: 58,877,157	T93P	probably damaging	Het
Ank3	G	T	10: 69,850,176	R273L	probably damaging	Het
Anks1b	G	A	10: 90,680,837	G898D	probably damaging	Het
Anxa11	C	T	14: 25,872,734	P131S	unknown	Het
Ap4e1	T	A	2: 127,047,115	M500K	probably benign	Het
Bag3	T	C	7: 128,540,198	S138P	probably damaging	Het
Capn9	T	C	8: 124,617,454	V670A	probably benign	Het
Ccne2	T	A	4: 11,199,306	W236R	probably damaging	Het
Cdh23	A	T	10: 60,426,672	Y702*	probably null	Het
Chd1l	G	A	3: 97,587,167	A399V	probably damaging	Het
Cit	A	T	5: 115,948,065	E896V	probably damaging	Het
Cntln	T	A	4: 85,096,761	N1096K	probably damaging	Het
Cntnap5c	T	C	17: 58,104,752	C544R	probably damaging	Het
Csf1	A	T	3: 107,748,359	L452Q	possibly damaging	Het
Cts8	T	A	13: 61,249,223	K294N	possibly damaging	Het
D430042O09Rik	T	C	7: 125,870,697	V1446A	probably benign	Het
Dcakd	T	G	11: 102,999,792	E56D	possibly damaging	Het
Dnah17	T	C	11: 118,108,161	I929V	probably benign	Het
Dnah2	G	T	11: 69,491,641	H1214Q	probably benign	Het
Dock9	T	C	14: 121,634,594	D536G	probably damaging	Het
Drc3	A	G	11: 60,393,770	N467S	possibly damaging	Het
Dysf	A	G	6: 84,107,136		probably null	Het
Evpl	A	T	11: 116,230,922	L378Q	probably damaging	Het
Fer1l4	A	T	2: 156,024,740	H1520Q	probably damaging	Het
Fhod1	A	T	8: 105,337,148		probably benign	Het
Gabra1	T	A	11: 42,182,378		probably benign	Het
Gm10549	C	A	18: 33,464,305		probably benign	Het
Gm14137	A	G	2: 119,175,091	T44A	possibly damaging	Het
Gm9833	T	C	3: 10,089,179	I336T	probably damaging	Het
Herc2	T	C	7: 56,191,265	M3444T	probably benign	Het
Igsf5	T	C	16: 96,396,448	S208P	possibly damaging	Het
Ino80b	A	G	6: 83,125,085	L12P	possibly damaging	Het
Insrr	A	G	3: 87,812,965	D970G	probably damaging	Het
Iqcf4	G	A	9: 106,568,675	A91V	probably benign	Het
Itga10	A	G	3: 96,656,762	T911A	probably benign	Het
Klhl30	A	T	1: 91,357,364	D314V	probably benign	Het
Lpcat1	T	C	13: 73,510,955	V330A	possibly damaging	Het
Nhlrc3	A	T	3: 53,452,523	D306E	possibly damaging	Het
Notum	T	A	11: 120,657,940	I187F	probably damaging	Het
Nphp3	T	C	9: 104,015,441	L288P	probably damaging	Het
Ntrk2	G	T	13: 58,871,756	E394*	probably null	Het
Olfr420	T	A	1: 174,152,182	V222D	probably benign	Het
Pbld2	A	G	10: 63,039,152	K63E	probably benign	Het
Phc2	T	C	4: 128,748,189	M768T	possibly damaging	Het
Pik3c2g	G	A	6: 139,626,563	C249Y	probably damaging	Het
Plod1	G	A	4: 147,916,315		probably benign	Het
Plscr2	A	T	9: 92,290,719	T9S	probably benign	Het
Pnrc1	T	A	4: 33,246,315	M215L	probably benign	Het
Prcp	G	T	7: 92,928,633	C370F	probably damaging	Het
Pter	A	G	2: 12,978,394	N70S	probably damaging	Het
Ptprt	G	T	2: 161,553,859	H1131Q	probably damaging	Het
Rasal2	T	C	1: 157,411,862	D8G	possibly damaging	Het
Rcn2	A	C	9: 56,052,925	K159Q	probably benign	Het
Rex2	T	A	4: 147,057,515	C153*	probably null	Het
Rps6ka2	T	C	17: 7,170,367	F8S	possibly damaging	Het
Sptb	A	G	12: 76,620,654		probably null	Het
Srgap3	A	T	6: 112,816,610	V135D	probably damaging	Het
Srsf7	T	C	17: 80,207,253		probably benign	Het
Tacc2	A	G	7: 130,626,525	T1647A	probably benign	Het
Thap12	G	T	7: 98,703,405	A6S	probably damaging	Het
Tmem33	T	A	5: 67,268,551	L146*	probably null	Het
Trip13	C	A	13: 73,936,259	E36*	probably null	Het
Vkorc1l1	T	A	5: 129,942,238	C23S	probably damaging	Het
Vmn1r20	G	A	6: 57,432,127	R146H	probably benign	Het
Vmn1r222	T	A	13: 23,232,795	I83F	probably benign	Het
Vmn2r107	A	T	17: 20,355,782	I125F	probably benign	Het
Vmn2r116	A	G	17: 23,386,762	D216G	probably damaging	Het
Vwa3a	C	T	7: 120,795,651	T898I	probably benign	Het
Wdfy3	T	C	5: 101,968,946	D76G	probably damaging	Het
Wdhd1	T	C	14: 47,273,122	D148G	possibly damaging	Het
Xylt1	T	C	7: 117,656,737	I844T	probably damaging	Het
Zfp106	A	T	2: 120,522,704	V1535D	probably damaging	Het
Zfp385b	A	T	2: 77,413,979	L315Q	possibly damaging	Het
Zfp458	T	A	13: 67,256,806	H523L	probably damaging	Het
Zfp712	T	C	13: 67,041,329	H378R	probably damaging	Het
Zic1	T	C	9: 91,364,503	Y172C	probably damaging	Het

Other mutations in Samd9l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00538:Samd9l	APN	6	3376779	missense	probably damaging	0.96
IGL00550:Samd9l	APN	6	3374594	missense	probably benign	0.00
IGL01100:Samd9l	APN	6	3375863	missense	possibly damaging	0.91
IGL01321:Samd9l	APN	6	3376259	missense	probably benign	0.42
IGL01553:Samd9l	APN	6	3375566	missense	probably damaging	0.99
IGL01575:Samd9l	APN	6	3376734	missense	possibly damaging	0.85
IGL01896:Samd9l	APN	6	3375120	missense	probably benign	0.02
IGL01915:Samd9l	APN	6	3373864	nonsense	probably null
IGL02063:Samd9l	APN	6	3372992	missense	probably damaging	1.00
IGL02066:Samd9l	APN	6	3376575	missense	probably damaging	1.00
IGL02145:Samd9l	APN	6	3374105	missense	probably benign	0.13
IGL02163:Samd9l	APN	6	3374246	missense	possibly damaging	0.90
IGL02256:Samd9l	APN	6	3376197	missense	probably damaging	1.00
IGL02508:Samd9l	APN	6	3374798	missense	probably damaging	1.00
IGL02591:Samd9l	APN	6	3375760	missense	possibly damaging	0.91
IGL02968:Samd9l	APN	6	3376026	missense	probably damaging	1.00
IGL03058:Samd9l	APN	6	3374980	missense	probably damaging	0.99
IGL03068:Samd9l	APN	6	3375348	nonsense	probably null
IGL03160:Samd9l	APN	6	3374894	missense	probably damaging	1.00
IGL03372:Samd9l	APN	6	3375314	missense	probably damaging	1.00
IGL03385:Samd9l	APN	6	3376208	missense	probably damaging	0.99
boston_lager	UTSW	6	3375761	missense	probably benign	0.12
ipa	UTSW	6	3376347	missense	probably damaging	1.00
Paine	UTSW	6	3372716	missense	probably damaging	0.99
samad	UTSW	6	3374032	nonsense	probably null
IGL03054:Samd9l	UTSW	6	3376023	missense	probably damaging	1.00
R0111:Samd9l	UTSW	6	3374946	missense	possibly damaging	0.80
R0112:Samd9l	UTSW	6	3376031	missense	possibly damaging	0.93
R0356:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R0370:Samd9l	UTSW	6	3377264	start gained	probably benign
R0398:Samd9l	UTSW	6	3374502	missense	probably damaging	1.00
R0744:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0833:Samd9l	UTSW	6	3372725	missense	possibly damaging	0.92
R0880:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R1110:Samd9l	UTSW	6	3374267	missense	probably benign	0.44
R1155:Samd9l	UTSW	6	3376939	missense	probably benign	0.01
R1268:Samd9l	UTSW	6	3376113	missense	possibly damaging	0.56
R1293:Samd9l	UTSW	6	3373947	missense	possibly damaging	0.93
R1478:Samd9l	UTSW	6	3376369	missense	probably benign	0.06
R1573:Samd9l	UTSW	6	3375426	missense	probably damaging	0.99
R1590:Samd9l	UTSW	6	3375761	missense	probably benign	0.12
R1611:Samd9l	UTSW	6	3373771	missense	probably benign	0.00
R1754:Samd9l	UTSW	6	3373126	missense	probably damaging	0.96
R1759:Samd9l	UTSW	6	3373401	missense	probably damaging	1.00
R1795:Samd9l	UTSW	6	3375264	nonsense	probably null
R1829:Samd9l	UTSW	6	3375107	missense	possibly damaging	0.69
R1935:Samd9l	UTSW	6	3376269	missense	probably benign	0.01
R2154:Samd9l	UTSW	6	3372945	missense	possibly damaging	0.91
R2228:Samd9l	UTSW	6	3376910	missense	probably benign	0.08
R3622:Samd9l	UTSW	6	3374032	nonsense	probably null
R3903:Samd9l	UTSW	6	3376830	nonsense	probably null
R3904:Samd9l	UTSW	6	3376830	nonsense	probably null
R3945:Samd9l	UTSW	6	3377029	missense	possibly damaging	0.71
R4091:Samd9l	UTSW	6	3376887	missense	probably benign	0.22
R4602:Samd9l	UTSW	6	3373935	missense	probably damaging	1.00
R4602:Samd9l	UTSW	6	3373937	frame shift	probably null
R4618:Samd9l	UTSW	6	3376347	missense	probably damaging	1.00
R4747:Samd9l	UTSW	6	3375504	nonsense	probably null
R4762:Samd9l	UTSW	6	3375623	missense	probably benign	0.01
R4814:Samd9l	UTSW	6	3372863	missense	probably damaging	0.98
R4934:Samd9l	UTSW	6	3375621	nonsense	probably null
R5026:Samd9l	UTSW	6	3375284	missense	possibly damaging	0.75
R5048:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R5130:Samd9l	UTSW	6	3374548	missense	possibly damaging	0.69
R5271:Samd9l	UTSW	6	3376156	missense	probably benign	0.02
R5328:Samd9l	UTSW	6	3376739	missense	probably damaging	0.99
R5507:Samd9l	UTSW	6	3373898	missense	possibly damaging	0.78
R5587:Samd9l	UTSW	6	3373291	missense	possibly damaging	0.84
R5846:Samd9l	UTSW	6	3376754	missense	probably benign
R5881:Samd9l	UTSW	6	3372716	missense	possibly damaging	0.70
R5889:Samd9l	UTSW	6	3376460	missense	probably damaging	1.00
R6131:Samd9l	UTSW	6	3377252	missense	probably benign	0.00
R6199:Samd9l	UTSW	6	3376686	missense	probably benign	0.13
R6331:Samd9l	UTSW	6	3376361	missense	probably damaging	1.00
R6489:Samd9l	UTSW	6	3376896	missense	probably benign
R6601:Samd9l	UTSW	6	3377229	missense	possibly damaging	0.74
R6655:Samd9l	UTSW	6	3377247	missense	probably benign	0.22
R6803:Samd9l	UTSW	6	3375446	missense	probably damaging	0.97
R6864:Samd9l	UTSW	6	3374750	missense	probably benign	0.14
R6905:Samd9l	UTSW	6	3375387	missense	probably damaging	0.99
R6919:Samd9l	UTSW	6	3376313	missense	possibly damaging	0.88
R7060:Samd9l	UTSW	6	3372716	missense	probably damaging	0.99
R7073:Samd9l	UTSW	6	3375856	nonsense	probably null
R7250:Samd9l	UTSW	6	3374201	missense	possibly damaging	0.78
R7307:Samd9l	UTSW	6	3372600	nonsense	probably null
R7351:Samd9l	UTSW	6	3374157	missense	probably benign	0.35
R7423:Samd9l	UTSW	6	3374408	missense	probably damaging	1.00
R7610:Samd9l	UTSW	6	3376754	missense	probably benign
R7667:Samd9l	UTSW	6	3375975	missense	possibly damaging	0.87
R7672:Samd9l	UTSW	6	3373646	missense	probably benign	0.16
R7680:Samd9l	UTSW	6	3372569	missense	probably damaging	1.00
R7680:Samd9l	UTSW	6	3376469	missense	probably damaging	1.00
R7814:Samd9l	UTSW	6	3374793	missense	possibly damaging	0.86
R7829:Samd9l	UTSW	6	3374749	missense	probably benign	0.00
R8000:Samd9l	UTSW	6	3373034	missense	probably damaging	1.00
R8098:Samd9l	UTSW	6	3375549	missense	probably damaging	1.00
R8698:Samd9l	UTSW	6	3373843	missense	probably benign	0.06
R8785:Samd9l	UTSW	6	3377064	missense	probably damaging	0.99
R8795:Samd9l	UTSW	6	3374221	nonsense	probably null
R8806:Samd9l	UTSW	6	3376665	missense	probably damaging	0.99
R8832:Samd9l	UTSW	6	3374990	missense	probably damaging	1.00
R8954:Samd9l	UTSW	6	3374577	missense	probably damaging	0.98
R9023:Samd9l	UTSW	6	3373791	missense	probably damaging	1.00
R9051:Samd9l	UTSW	6	3373493	missense	probably benign	0.16
R9108:Samd9l	UTSW	6	3373104	missense	possibly damaging	0.71
R9213:Samd9l	UTSW	6	3376856	missense	probably benign	0.23
R9494:Samd9l	UTSW	6	3375830	missense	possibly damaging	0.51
R9504:Samd9l	UTSW	6	3372621	missense	probably benign	0.17
R9655:Samd9l	UTSW	6	3373578	missense	probably benign	0.00
R9688:Samd9l	UTSW	6	3377087	missense	probably damaging	1.00
R9696:Samd9l	UTSW	6	3375078	missense	possibly damaging	0.76
R9721:Samd9l	UTSW	6	3375854	missense	possibly damaging	0.69
X0026:Samd9l	UTSW	6	3375560	missense	probably damaging	1.00
X0066:Samd9l	UTSW	6	3374477	missense	probably damaging	1.00
Z1176:Samd9l	UTSW	6	3376770	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAGGAGAGTCTGCACACTGTTG -3'
(R):5'- TGTGTATCTGTGTCAACTCAGC -3'

Sequencing Primer
(F):5'- GAGTCTGCACACTGTTGTATTAATG -3'
(R):5'- TGTGTCAACTCAGCTATCTACCAAC -3'

Posted On

2018-04-02