Incidental Mutation 'R6298:Nphp3'
ID508909
Institutional Source Beutler Lab
Gene Symbol Nphp3
Ensembl Gene ENSMUSG00000032558
Gene Namenephronophthisis 3 (adolescent)
Synonyms3632410F03Rik, D330020E01Rik, pcy, nephrocystin 3
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6298 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location104002544-104043818 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 104015441 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 288 (L288P)
Ref Sequence ENSEMBL: ENSMUSP00000141596 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035167] [ENSMUST00000193439] [ENSMUST00000194774]
Predicted Effect possibly damaging
Transcript: ENSMUST00000035167
AA Change: L408P

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000035167
Gene: ENSMUSG00000032558
AA Change: L408P

DomainStartEndE-ValueType
low complexity region 46 69 N/A INTRINSIC
coiled coil region 107 203 N/A INTRINSIC
low complexity region 512 537 N/A INTRINSIC
low complexity region 613 627 N/A INTRINSIC
low complexity region 640 650 N/A INTRINSIC
TPR 938 971 3.16e1 SMART
TPR 980 1013 7.74e-2 SMART
TPR 1022 1055 3.24e1 SMART
low complexity region 1066 1080 N/A INTRINSIC
TPR 1088 1121 3.67e-3 SMART
TPR 1130 1163 1.3e-3 SMART
TPR 1172 1205 4.38e-1 SMART
TPR 1214 1247 8.69e-5 SMART
TPR 1256 1289 9.03e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191919
Predicted Effect possibly damaging
Transcript: ENSMUST00000193439
AA Change: L314P

PolyPhen 2 Score 0.849 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000141540
Gene: ENSMUSG00000032558
AA Change: L314P

DomainStartEndE-ValueType
coiled coil region 75 109 N/A INTRINSIC
low complexity region 418 443 N/A INTRINSIC
low complexity region 519 532 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193642
Predicted Effect probably damaging
Transcript: ENSMUST00000194774
AA Change: L288P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000141596
Gene: ENSMUSG00000032558
AA Change: L288P

DomainStartEndE-ValueType
coiled coil region 49 83 N/A INTRINSIC
Pfam:NACHT 400 559 2e-6 PFAM
TPR 818 851 3.16e1 SMART
TPR 860 893 7.74e-2 SMART
TPR 902 935 3.24e1 SMART
low complexity region 946 960 N/A INTRINSIC
TPR 968 1001 3.67e-3 SMART
TPR 1010 1043 1.3e-3 SMART
TPR 1052 1085 4.38e-1 SMART
TPR 1094 1127 8.69e-5 SMART
TPR 1136 1169 9.03e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing a coiled-coil (CC) domain, a tubulin-tyrosine ligase (TTL) domain, and a tetratrico peptide repeat (TPR) domain. The encoded protein interacts with nephrocystin, it is required for normal ciliary development, and it functions in renal tubular development. Mutations in this gene are associated with nephronophthisis type 3, and also with renal-hepatic-pancreatic dysplasia, and Meckel syndrome type 7. Naturally occurring read-through transcripts exist between this gene and the downstream ACAD11 (acyl-CoA dehydrogenase family, member 11) gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Homozygous hypomorphic mice display slowly progressing kidney cysts, enlarged kidneys, increased blood urea nitrogen, kidney inflammation and associated fibrosis, and premature death. Homozygous null mice display mid gestational lethality with partial penetrance of situs inversus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T A 13: 98,984,466 R17S probably benign Het
Abtb2 A T 2: 103,709,488 M733L probably benign Het
Acss3 G A 10: 107,084,856 P131L probably damaging Het
Adgrv1 T A 13: 81,391,767 I5678F probably benign Het
Aff1 C T 5: 103,754,720 L6F possibly damaging Het
AI314180 T G 4: 58,877,157 T93P probably damaging Het
Ank3 G T 10: 69,850,176 R273L probably damaging Het
Anks1b G A 10: 90,680,837 G898D probably damaging Het
Anxa11 C T 14: 25,872,734 P131S unknown Het
Ap4e1 T A 2: 127,047,115 M500K probably benign Het
Bag3 T C 7: 128,540,198 S138P probably damaging Het
Capn9 T C 8: 124,617,454 V670A probably benign Het
Ccne2 T A 4: 11,199,306 W236R probably damaging Het
Cdh23 A T 10: 60,426,672 Y702* probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cit A T 5: 115,948,065 E896V probably damaging Het
Cntln T A 4: 85,096,761 N1096K probably damaging Het
Cntnap5c T C 17: 58,104,752 C544R probably damaging Het
Csf1 A T 3: 107,748,359 L452Q possibly damaging Het
Cts8 T A 13: 61,249,223 K294N possibly damaging Het
D430042O09Rik T C 7: 125,870,697 V1446A probably benign Het
Dcakd T G 11: 102,999,792 E56D possibly damaging Het
Dnah17 T C 11: 118,108,161 I929V probably benign Het
Dnah2 G T 11: 69,491,641 H1214Q probably benign Het
Dock9 T C 14: 121,634,594 D536G probably damaging Het
Drc3 A G 11: 60,393,770 N467S possibly damaging Het
Dysf A G 6: 84,107,136 probably null Het
Evpl A T 11: 116,230,922 L378Q probably damaging Het
Fer1l4 A T 2: 156,024,740 H1520Q probably damaging Het
Fhod1 A T 8: 105,337,148 probably benign Het
Gabra1 T A 11: 42,182,378 probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14137 A G 2: 119,175,091 T44A possibly damaging Het
Gm9833 T C 3: 10,089,179 I336T probably damaging Het
Herc2 T C 7: 56,191,265 M3444T probably benign Het
Igsf5 T C 16: 96,396,448 S208P possibly damaging Het
Ino80b A G 6: 83,125,085 L12P possibly damaging Het
Insrr A G 3: 87,812,965 D970G probably damaging Het
Iqcf4 G A 9: 106,568,675 A91V probably benign Het
Itga10 A G 3: 96,656,762 T911A probably benign Het
Klhl30 A T 1: 91,357,364 D314V probably benign Het
Lpcat1 T C 13: 73,510,955 V330A possibly damaging Het
Nhlrc3 A T 3: 53,452,523 D306E possibly damaging Het
Notum T A 11: 120,657,940 I187F probably damaging Het
Ntrk2 G T 13: 58,871,756 E394* probably null Het
Olfr420 T A 1: 174,152,182 V222D probably benign Het
Pbld2 A G 10: 63,039,152 K63E probably benign Het
Phc2 T C 4: 128,748,189 M768T possibly damaging Het
Pik3c2g G A 6: 139,626,563 C249Y probably damaging Het
Plod1 G A 4: 147,916,315 probably benign Het
Plscr2 A T 9: 92,290,719 T9S probably benign Het
Pnrc1 T A 4: 33,246,315 M215L probably benign Het
Prcp G T 7: 92,928,633 C370F probably damaging Het
Pter A G 2: 12,978,394 N70S probably damaging Het
Ptprt G T 2: 161,553,859 H1131Q probably damaging Het
Rasal2 T C 1: 157,411,862 D8G possibly damaging Het
Rcn2 A C 9: 56,052,925 K159Q probably benign Het
Rex2 T A 4: 147,057,515 C153* probably null Het
Rps6ka2 T C 17: 7,170,367 F8S possibly damaging Het
Samd9l A G 6: 3,375,383 L626S probably damaging Het
Sptb A G 12: 76,620,654 probably null Het
Srgap3 A T 6: 112,816,610 V135D probably damaging Het
Srsf7 T C 17: 80,207,253 probably benign Het
Tacc2 A G 7: 130,626,525 T1647A probably benign Het
Thap12 G T 7: 98,703,405 A6S probably damaging Het
Tmem33 T A 5: 67,268,551 L146* probably null Het
Trip13 C A 13: 73,936,259 E36* probably null Het
Vkorc1l1 T A 5: 129,942,238 C23S probably damaging Het
Vmn1r20 G A 6: 57,432,127 R146H probably benign Het
Vmn1r222 T A 13: 23,232,795 I83F probably benign Het
Vmn2r107 A T 17: 20,355,782 I125F probably benign Het
Vmn2r116 A G 17: 23,386,762 D216G probably damaging Het
Vwa3a C T 7: 120,795,651 T898I probably benign Het
Wdfy3 T C 5: 101,968,946 D76G probably damaging Het
Wdhd1 T C 14: 47,273,122 D148G possibly damaging Het
Xylt1 T C 7: 117,656,737 I844T probably damaging Het
Zfp106 A T 2: 120,522,704 V1535D probably damaging Het
Zfp385b A T 2: 77,413,979 L315Q possibly damaging Het
Zfp458 T A 13: 67,256,806 H523L probably damaging Het
Zfp712 T C 13: 67,041,329 H378R probably damaging Het
Zic1 T C 9: 91,364,503 Y172C probably damaging Het
Other mutations in Nphp3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01707:Nphp3 APN 9 104018158 missense possibly damaging 0.75
IGL02329:Nphp3 APN 9 104025968 missense probably benign 0.19
lithograph UTSW 9 104041990 missense probably damaging 1.00
F5770:Nphp3 UTSW 9 104035894 critical splice donor site probably null
FR4548:Nphp3 UTSW 9 104025939 small deletion probably benign
FR4589:Nphp3 UTSW 9 104025939 small deletion probably benign
R0112:Nphp3 UTSW 9 104037348 missense possibly damaging 0.80
R0555:Nphp3 UTSW 9 104023434 missense probably damaging 1.00
R0632:Nphp3 UTSW 9 104018274 missense probably damaging 1.00
R0674:Nphp3 UTSW 9 104036282 critical splice donor site probably null
R0743:Nphp3 UTSW 9 104022768 small deletion probably benign
R0853:Nphp3 UTSW 9 104031933 missense probably benign 0.03
R0920:Nphp3 UTSW 9 104031907 missense probably benign 0.00
R1420:Nphp3 UTSW 9 104035893 critical splice donor site probably null
R1464:Nphp3 UTSW 9 104031879 splice site probably benign
R1476:Nphp3 UTSW 9 104025927 missense possibly damaging 0.81
R1585:Nphp3 UTSW 9 104009214 missense probably damaging 1.00
R1608:Nphp3 UTSW 9 104035840 missense probably benign 0.30
R1688:Nphp3 UTSW 9 104003124 missense probably damaging 1.00
R1691:Nphp3 UTSW 9 104002811 missense probably benign
R1807:Nphp3 UTSW 9 104020741 missense probably benign 0.01
R1857:Nphp3 UTSW 9 104021294 missense possibly damaging 0.87
R1962:Nphp3 UTSW 9 104021338 missense probably benign 0.00
R2127:Nphp3 UTSW 9 104008243 missense probably damaging 0.98
R2138:Nphp3 UTSW 9 104025903 missense possibly damaging 0.89
R2233:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R2234:Nphp3 UTSW 9 104037376 missense probably benign 0.02
R3861:Nphp3 UTSW 9 104039326 unclassified probably benign
R3928:Nphp3 UTSW 9 104011730 missense probably damaging 0.99
R3961:Nphp3 UTSW 9 104003042 nonsense probably null
R4182:Nphp3 UTSW 9 104038464 missense probably benign 0.06
R4294:Nphp3 UTSW 9 104022717 missense probably damaging 1.00
R4387:Nphp3 UTSW 9 104030020 missense possibly damaging 0.94
R4625:Nphp3 UTSW 9 104036159 missense possibly damaging 0.66
R4628:Nphp3 UTSW 9 104003058 missense probably damaging 0.99
R4696:Nphp3 UTSW 9 104022732 missense probably benign 0.01
R4865:Nphp3 UTSW 9 104031970 missense probably benign
R4886:Nphp3 UTSW 9 104002994 missense probably damaging 1.00
R4973:Nphp3 UTSW 9 104031999 missense probably benign
R5445:Nphp3 UTSW 9 104004723 missense probably damaging 1.00
R5451:Nphp3 UTSW 9 104042022 missense probably benign
R5520:Nphp3 UTSW 9 104024673 missense probably benign 0.30
R5641:Nphp3 UTSW 9 104036153 missense probably damaging 1.00
R5847:Nphp3 UTSW 9 104003037 missense probably damaging 1.00
R5928:Nphp3 UTSW 9 104035797 missense probably benign 0.01
R5931:Nphp3 UTSW 9 104020746 missense probably damaging 1.00
R6161:Nphp3 UTSW 9 104031906 missense probably benign 0.11
R6890:Nphp3 UTSW 9 104041954 missense probably damaging 0.96
R7009:Nphp3 UTSW 9 104016116 missense probably null 0.00
R7065:Nphp3 UTSW 9 104041990 missense probably damaging 1.00
R7146:Nphp3 UTSW 9 104004837 nonsense probably null
R7198:Nphp3 UTSW 9 104004775 missense probably damaging 1.00
R7360:Nphp3 UTSW 9 104016078 critical splice acceptor site probably null
R7369:Nphp3 UTSW 9 104018250 missense probably damaging 0.99
R7554:Nphp3 UTSW 9 104042071 missense probably damaging 0.98
R7591:Nphp3 UTSW 9 104018278 critical splice donor site probably null
R7672:Nphp3 UTSW 9 104031960 missense probably benign
R7675:Nphp3 UTSW 9 104016088 missense probably benign
V7583:Nphp3 UTSW 9 104035894 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGGTAAAAGCTCGTTTGGGC -3'
(R):5'- TTCCCAGGCTGGATCTCATTG -3'

Sequencing Primer
(F):5'- AAAAGCTCGTTTGGGCACTTAG -3'
(R):5'- TGGATCTCATTGGGCCACC -3'
Posted On2018-04-02