Incidental Mutation 'R6298:Wdhd1'
ID508934
Institutional Source Beutler Lab
Gene Symbol Wdhd1
Ensembl Gene ENSMUSG00000037572
Gene NameWD repeat and HMG-box DNA binding protein 1
SynonymsAND-1, D630024B06Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6298 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location47240944-47276857 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 47273122 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 148 (D148G)
Ref Sequence ENSEMBL: ENSMUSP00000141182 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000065562] [ENSMUST00000111790] [ENSMUST00000111791] [ENSMUST00000111792] [ENSMUST00000187531] [ENSMUST00000227413]
Predicted Effect probably benign
Transcript: ENSMUST00000065562
SMART Domains Protein: ENSMUSP00000066031
Gene: ENSMUSG00000048379

DomainStartEndE-ValueType
low complexity region 30 47 N/A INTRINSIC
Pfam:SOCS 55 108 6.8e-23 PFAM
low complexity region 219 232 N/A INTRINSIC
SH2 281 367 1.11e-16 SMART
SOCS 377 420 1.69e-16 SMART
SOCS_box 383 419 1.13e-9 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000111790
AA Change: D148G

PolyPhen 2 Score 0.585 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107420
Gene: ENSMUSG00000037572
AA Change: D148G

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:DUF3639 525 551 2.4e-13 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000111791
AA Change: D148G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000107421
Gene: ENSMUSG00000037572
AA Change: D148G

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:Mcl1_mid 424 708 1.6e-103 PFAM
coiled coil region 802 834 N/A INTRINSIC
HMG 1003 1073 2.64e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111792
AA Change: D148G

PolyPhen 2 Score 0.430 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000107422
Gene: ENSMUSG00000037572
AA Change: D148G

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 316 326 N/A INTRINSIC
Pfam:DUF3639 488 514 7.1e-13 PFAM
coiled coil region 765 797 N/A INTRINSIC
HMG 966 1036 2.64e-12 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000122699
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139124
Predicted Effect possibly damaging
Transcript: ENSMUST00000187531
AA Change: D148G

PolyPhen 2 Score 0.668 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000141182
Gene: ENSMUSG00000037572
AA Change: D148G

DomainStartEndE-ValueType
WD40 4 41 8.62e-4 SMART
WD40 83 122 8.91e-1 SMART
WD40 125 164 1.67e-10 SMART
WD40 217 258 6.19e-1 SMART
WD40 261 301 5.11e1 SMART
low complexity region 353 363 N/A INTRINSIC
Pfam:DUF3639 525 551 3e-13 PFAM
coiled coil region 802 834 N/A INTRINSIC
HMG 1003 1073 2.64e-12 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000227413
Predicted Effect noncoding transcript
Transcript: ENSMUST00000228623
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.5%
  • 20x: 98.5%
Validation Efficiency 98% (79/81)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains multiple N-terminal WD40 domains and a C-terminal high mobility group (HMG) box. WD40 domains are found in a variety of eukaryotic proteins and may function as adaptor/regulatory modules in signal transduction, pre-mRNA processing and cytoskeleton assembly. HMG boxes are found in many eukaryotic proteins involved in chromatin assembly, transcription and replication. Alternative splicing results in two transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 81 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700024P04Rik T A 13: 98,984,466 R17S probably benign Het
Abtb2 A T 2: 103,709,488 M733L probably benign Het
Acss3 G A 10: 107,084,856 P131L probably damaging Het
Adgrv1 T A 13: 81,391,767 I5678F probably benign Het
Aff1 C T 5: 103,754,720 L6F possibly damaging Het
AI314180 T G 4: 58,877,157 T93P probably damaging Het
Ank3 G T 10: 69,850,176 R273L probably damaging Het
Anks1b G A 10: 90,680,837 G898D probably damaging Het
Anxa11 C T 14: 25,872,734 P131S unknown Het
Ap4e1 T A 2: 127,047,115 M500K probably benign Het
Bag3 T C 7: 128,540,198 S138P probably damaging Het
Capn9 T C 8: 124,617,454 V670A probably benign Het
Ccne2 T A 4: 11,199,306 W236R probably damaging Het
Cdh23 A T 10: 60,426,672 Y702* probably null Het
Chd1l G A 3: 97,587,167 A399V probably damaging Het
Cit A T 5: 115,948,065 E896V probably damaging Het
Cntln T A 4: 85,096,761 N1096K probably damaging Het
Cntnap5c T C 17: 58,104,752 C544R probably damaging Het
Csf1 A T 3: 107,748,359 L452Q possibly damaging Het
Cts8 T A 13: 61,249,223 K294N possibly damaging Het
D430042O09Rik T C 7: 125,870,697 V1446A probably benign Het
Dcakd T G 11: 102,999,792 E56D possibly damaging Het
Dnah17 T C 11: 118,108,161 I929V probably benign Het
Dnah2 G T 11: 69,491,641 H1214Q probably benign Het
Dock9 T C 14: 121,634,594 D536G probably damaging Het
Drc3 A G 11: 60,393,770 N467S possibly damaging Het
Dysf A G 6: 84,107,136 probably null Het
Evpl A T 11: 116,230,922 L378Q probably damaging Het
Fer1l4 A T 2: 156,024,740 H1520Q probably damaging Het
Fhod1 A T 8: 105,337,148 probably benign Het
Gabra1 T A 11: 42,182,378 probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Gm14137 A G 2: 119,175,091 T44A possibly damaging Het
Gm9833 T C 3: 10,089,179 I336T probably damaging Het
Herc2 T C 7: 56,191,265 M3444T probably benign Het
Igsf5 T C 16: 96,396,448 S208P possibly damaging Het
Ino80b A G 6: 83,125,085 L12P possibly damaging Het
Insrr A G 3: 87,812,965 D970G probably damaging Het
Iqcf4 G A 9: 106,568,675 A91V probably benign Het
Itga10 A G 3: 96,656,762 T911A probably benign Het
Klhl30 A T 1: 91,357,364 D314V probably benign Het
Lpcat1 T C 13: 73,510,955 V330A possibly damaging Het
Nhlrc3 A T 3: 53,452,523 D306E possibly damaging Het
Notum T A 11: 120,657,940 I187F probably damaging Het
Nphp3 T C 9: 104,015,441 L288P probably damaging Het
Ntrk2 G T 13: 58,871,756 E394* probably null Het
Olfr420 T A 1: 174,152,182 V222D probably benign Het
Pbld2 A G 10: 63,039,152 K63E probably benign Het
Phc2 T C 4: 128,748,189 M768T possibly damaging Het
Pik3c2g G A 6: 139,626,563 C249Y probably damaging Het
Plod1 G A 4: 147,916,315 probably benign Het
Plscr2 A T 9: 92,290,719 T9S probably benign Het
Pnrc1 T A 4: 33,246,315 M215L probably benign Het
Prcp G T 7: 92,928,633 C370F probably damaging Het
Pter A G 2: 12,978,394 N70S probably damaging Het
Ptprt G T 2: 161,553,859 H1131Q probably damaging Het
Rasal2 T C 1: 157,411,862 D8G possibly damaging Het
Rcn2 A C 9: 56,052,925 K159Q probably benign Het
Rex2 T A 4: 147,057,515 C153* probably null Het
Rps6ka2 T C 17: 7,170,367 F8S possibly damaging Het
Samd9l A G 6: 3,375,383 L626S probably damaging Het
Sptb A G 12: 76,620,654 probably null Het
Srgap3 A T 6: 112,816,610 V135D probably damaging Het
Srsf7 T C 17: 80,207,253 probably benign Het
Tacc2 A G 7: 130,626,525 T1647A probably benign Het
Thap12 G T 7: 98,703,405 A6S probably damaging Het
Tmem33 T A 5: 67,268,551 L146* probably null Het
Trip13 C A 13: 73,936,259 E36* probably null Het
Vkorc1l1 T A 5: 129,942,238 C23S probably damaging Het
Vmn1r20 G A 6: 57,432,127 R146H probably benign Het
Vmn1r222 T A 13: 23,232,795 I83F probably benign Het
Vmn2r107 A T 17: 20,355,782 I125F probably benign Het
Vmn2r116 A G 17: 23,386,762 D216G probably damaging Het
Vwa3a C T 7: 120,795,651 T898I probably benign Het
Wdfy3 T C 5: 101,968,946 D76G probably damaging Het
Xylt1 T C 7: 117,656,737 I844T probably damaging Het
Zfp106 A T 2: 120,522,704 V1535D probably damaging Het
Zfp385b A T 2: 77,413,979 L315Q possibly damaging Het
Zfp458 T A 13: 67,256,806 H523L probably damaging Het
Zfp712 T C 13: 67,041,329 H378R probably damaging Het
Zic1 T C 9: 91,364,503 Y172C probably damaging Het
Other mutations in Wdhd1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01335:Wdhd1 APN 14 47250782 missense possibly damaging 0.87
IGL01789:Wdhd1 APN 14 47274817 missense probably benign 0.10
IGL01981:Wdhd1 APN 14 47261450 missense probably damaging 1.00
IGL02034:Wdhd1 APN 14 47261351 missense probably benign 0.02
IGL02932:Wdhd1 APN 14 47272134 critical splice donor site probably null
IGL02966:Wdhd1 APN 14 47241644 missense possibly damaging 0.93
IGL03355:Wdhd1 APN 14 47243889 missense possibly damaging 0.78
R0165:Wdhd1 UTSW 14 47267068 missense probably benign 0.00
R0414:Wdhd1 UTSW 14 47276588 missense probably benign
R0603:Wdhd1 UTSW 14 47263586 missense probably damaging 1.00
R1503:Wdhd1 UTSW 14 47247400 missense probably benign 0.00
R1539:Wdhd1 UTSW 14 47245050 missense possibly damaging 0.63
R1541:Wdhd1 UTSW 14 47268192 nonsense probably null
R1588:Wdhd1 UTSW 14 47256236 missense probably damaging 1.00
R1686:Wdhd1 UTSW 14 47256215 missense probably damaging 1.00
R1916:Wdhd1 UTSW 14 47258577 missense possibly damaging 0.89
R1952:Wdhd1 UTSW 14 47270190 missense probably damaging 1.00
R2320:Wdhd1 UTSW 14 47274028 missense probably benign 0.06
R2421:Wdhd1 UTSW 14 47258584 missense probably benign 0.00
R3731:Wdhd1 UTSW 14 47247892 missense possibly damaging 0.89
R3818:Wdhd1 UTSW 14 47243801 critical splice donor site probably null
R3836:Wdhd1 UTSW 14 47245054 missense probably benign 0.01
R4789:Wdhd1 UTSW 14 47268692 missense probably benign 0.01
R4963:Wdhd1 UTSW 14 47268689 missense possibly damaging 0.66
R4994:Wdhd1 UTSW 14 47268654 critical splice donor site probably null
R5225:Wdhd1 UTSW 14 47250816 missense probably benign 0.01
R5347:Wdhd1 UTSW 14 47268724 nonsense probably null
R5377:Wdhd1 UTSW 14 47272221 missense probably benign 0.15
R6038:Wdhd1 UTSW 14 47263580 missense possibly damaging 0.89
R6038:Wdhd1 UTSW 14 47263580 missense possibly damaging 0.89
R6046:Wdhd1 UTSW 14 47273210 nonsense probably null
R6156:Wdhd1 UTSW 14 47268196 missense probably damaging 0.99
R6289:Wdhd1 UTSW 14 47258496 missense possibly damaging 0.95
R6345:Wdhd1 UTSW 14 47251922 missense probably damaging 0.99
R6405:Wdhd1 UTSW 14 47243867 missense possibly damaging 0.91
R6500:Wdhd1 UTSW 14 47250760 splice site probably null
R6564:Wdhd1 UTSW 14 47248042 missense probably benign
R6897:Wdhd1 UTSW 14 47248130 missense probably damaging 1.00
R7262:Wdhd1 UTSW 14 47251973 missense probably benign 0.08
R7444:Wdhd1 UTSW 14 47251948 nonsense probably null
R7496:Wdhd1 UTSW 14 47274024 missense probably benign 0.39
R7503:Wdhd1 UTSW 14 47250791 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- AGTTCCATCACAACTAGCCG -3'
(R):5'- TTTAAAGCTGGCTTTAGAAGAGGC -3'

Sequencing Primer
(F):5'- TCACAACTAGCCGATGCCTG -3'
(R):5'- AGAAGAGGCGTCTGTATTGGC -3'
Posted On2018-04-02