Incidental Mutation 'R6299:Trpm8'
ID508943
Institutional Source Beutler Lab
Gene Symbol Trpm8
Ensembl Gene ENSMUSG00000036251
Gene Nametransient receptor potential cation channel, subfamily M, member 8
SynonymsCMR1, Trp-p8, TRPP8
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.252) question?
Stock #R6299 (G1)
Quality Score225.009
Status Validated
Chromosome1
Chromosomal Location88277661-88389293 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 88354479 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 699 (L699Q)
Ref Sequence ENSEMBL: ENSMUSP00000131209 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040210] [ENSMUST00000113114] [ENSMUST00000171176]
Predicted Effect probably damaging
Transcript: ENSMUST00000040210
AA Change: L699Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036991
Gene: ENSMUSG00000036251
AA Change: L699Q

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
Pfam:Ion_trans 769 979 4.7e-10 PFAM
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113114
AA Change: L699Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108739
Gene: ENSMUSG00000036251
AA Change: L699Q

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
Pfam:Ion_trans 769 979 4.7e-10 PFAM
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147594
Predicted Effect probably damaging
Transcript: ENSMUST00000171176
AA Change: L699Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000131209
Gene: ENSMUSG00000036251
AA Change: L699Q

DomainStartEndE-ValueType
low complexity region 25 40 N/A INTRINSIC
transmembrane domain 693 712 N/A INTRINSIC
transmembrane domain 724 758 N/A INTRINSIC
transmembrane domain 763 780 N/A INTRINSIC
transmembrane domain 793 815 N/A INTRINSIC
transmembrane domain 825 847 N/A INTRINSIC
transmembrane domain 867 889 N/A INTRINSIC
transmembrane domain 954 976 N/A INTRINSIC
low complexity region 1026 1036 N/A INTRINSIC
coiled coil region 1069 1104 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (61/61)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit decreased sensitivity to cold and reduced response to cold stimuli. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 G A 6: 118,418,515 R24W probably damaging Het
C130050O18Rik A T 5: 139,414,371 S60C probably damaging Het
Cabcoco1 A G 10: 68,436,890 Y222H probably damaging Het
Cc2d1b T C 4: 108,628,138 V559A probably benign Het
Cgrrf1 T A 14: 46,840,190 N46K probably damaging Het
Clca3a1 T C 3: 144,758,514 D114G probably damaging Het
Clcnkb T A 4: 141,410,723 L279F probably damaging Het
Cr2 T C 1: 195,168,646 T151A probably damaging Het
Creb3l3 C T 10: 81,088,613 E236K probably damaging Het
Dcstamp T A 15: 39,755,203 V336D probably damaging Het
Dopey1 T G 9: 86,504,212 F379V probably damaging Het
Esf1 T C 2: 140,123,634 K714R possibly damaging Het
Exoc3l4 A T 12: 111,422,079 M1L possibly damaging Het
Extl3 T C 14: 65,076,672 R354G probably benign Het
Fastkd3 T C 13: 68,587,736 L535P probably damaging Het
Gab2 A G 7: 97,081,859 T12A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Golga4 T A 9: 118,557,370 S1187T probably benign Het
Haus3 A G 5: 34,167,796 V173A probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hspg2 A G 4: 137,544,705 Y2566C probably damaging Het
Inpp5f A T 7: 128,636,160 T34S possibly damaging Het
Iqck G A 7: 118,876,262 G70S unknown Het
Jade1 T C 3: 41,613,725 F743L probably damaging Het
Kif5a T C 10: 127,233,821 K845R probably damaging Het
Klhl30 A G 1: 91,357,914 probably null Het
Map2k1 T C 9: 64,214,490 D67G possibly damaging Het
Mcm9 A C 10: 53,537,681 C434W probably damaging Het
Muc4 T G 16: 32,752,035 S638A possibly damaging Het
Nectin3 A G 16: 46,463,982 V113A probably damaging Het
Nfya T C 17: 48,392,910 probably benign Het
Nup155 G T 15: 8,128,438 A460S possibly damaging Het
Nup210 T C 6: 91,074,288 E371G possibly damaging Het
Olfm3 T C 3: 115,120,983 S228P probably damaging Het
Olfr659 C A 7: 104,670,868 D55E probably benign Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Plin1 A C 7: 79,721,476 V500G probably benign Het
Ppfia1 A C 7: 144,510,312 M513R probably benign Het
Ppp1cb T A 5: 32,483,454 C27* probably null Het
Prss22 T A 17: 23,996,434 I123F probably damaging Het
Rbm24 G T 13: 46,419,073 V15L probably damaging Het
Reln T C 5: 22,286,944 T97A possibly damaging Het
Sipa1l2 T C 8: 125,453,464 T1065A possibly damaging Het
Sipa1l3 A C 7: 29,366,549 probably null Het
Snrnp200 T A 2: 127,222,161 Y689* probably null Het
Srcap T C 7: 127,530,454 probably benign Het
Sv2a T C 3: 96,188,249 probably null Het
Tcf12 A T 9: 71,858,929 V474D probably damaging Het
Tpcn2 A T 7: 145,262,243 S403T probably damaging Het
Trim65 C A 11: 116,126,551 A362S probably benign Het
Trmt1 T A 8: 84,697,290 C36* probably null Het
Ube2m A C 7: 13,035,870 I116R probably damaging Het
Ulk1 T C 5: 110,791,097 K492E possibly damaging Het
Usp40 T A 1: 87,997,927 K193N probably damaging Het
Vmn1r3 A G 4: 3,185,098 S70P possibly damaging Het
Vmn2r2 T A 3: 64,116,653 K836* probably null Het
Vmn2r75 T A 7: 86,165,274 H337L probably benign Het
Wars G A 12: 108,861,383 T437M probably benign Het
Zdhhc5 T C 2: 84,690,481 T451A probably benign Het
Zfp788 T G 7: 41,648,541 H180Q possibly damaging Het
Zkscan7 A G 9: 122,888,717 E59G probably damaging Het
Other mutations in Trpm8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Trpm8 APN 1 88379827 missense possibly damaging 0.82
IGL01387:Trpm8 APN 1 88343287 missense probably damaging 1.00
IGL01933:Trpm8 APN 1 88326405 missense probably damaging 0.98
IGL02075:Trpm8 APN 1 88325488 missense probably damaging 1.00
IGL02184:Trpm8 APN 1 88330694 critical splice acceptor site probably null
IGL02342:Trpm8 APN 1 88328250 missense possibly damaging 0.58
IGL02416:Trpm8 APN 1 88360716 missense probably damaging 1.00
IGL02696:Trpm8 APN 1 88348051 missense probably damaging 1.00
IGL02807:Trpm8 APN 1 88348108 missense probably damaging 1.00
R0078:Trpm8 UTSW 1 88328148 splice site probably benign
R1183:Trpm8 UTSW 1 88348091 missense probably damaging 1.00
R1608:Trpm8 UTSW 1 88326432 missense probably benign
R1713:Trpm8 UTSW 1 88365080 missense probably damaging 1.00
R1724:Trpm8 UTSW 1 88350856 missense possibly damaging 0.86
R1966:Trpm8 UTSW 1 88332748 splice site probably null
R2089:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2091:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2091:Trpm8 UTSW 1 88343326 missense probably damaging 0.99
R2384:Trpm8 UTSW 1 88359656 missense probably benign 0.00
R2475:Trpm8 UTSW 1 88354449 missense probably damaging 1.00
R3726:Trpm8 UTSW 1 88328196 missense probably benign 0.00
R3745:Trpm8 UTSW 1 88348327 missense probably benign 0.21
R4063:Trpm8 UTSW 1 88362005 missense probably damaging 1.00
R4678:Trpm8 UTSW 1 88337129 missense probably benign 0.07
R4681:Trpm8 UTSW 1 88384705 missense possibly damaging 0.63
R5031:Trpm8 UTSW 1 88348188 missense probably benign 0.00
R5620:Trpm8 UTSW 1 88359651 critical splice acceptor site probably null
R5644:Trpm8 UTSW 1 88359739 missense possibly damaging 0.54
R5734:Trpm8 UTSW 1 88355280 missense probably benign 0.01
R5839:Trpm8 UTSW 1 88325506 missense possibly damaging 0.57
R5844:Trpm8 UTSW 1 88384711 makesense probably null
R5845:Trpm8 UTSW 1 88328180 missense probably benign 0.00
R5926:Trpm8 UTSW 1 88330747 missense probably damaging 0.99
R5940:Trpm8 UTSW 1 88351415 nonsense probably null
R6031:Trpm8 UTSW 1 88354469 missense possibly damaging 0.95
R6031:Trpm8 UTSW 1 88354469 missense possibly damaging 0.95
R6088:Trpm8 UTSW 1 88306678 start gained probably benign
R6283:Trpm8 UTSW 1 88348332 missense probably benign 0.09
R6367:Trpm8 UTSW 1 88359683 missense probably damaging 1.00
R6526:Trpm8 UTSW 1 88361998 missense probably damaging 0.98
R6682:Trpm8 UTSW 1 88326502 missense probably damaging 0.96
R6751:Trpm8 UTSW 1 88384706 missense possibly damaging 0.63
R7057:Trpm8 UTSW 1 88362080 missense probably null 0.99
R7489:Trpm8 UTSW 1 88379759 missense possibly damaging 0.85
R7520:Trpm8 UTSW 1 88343321 missense probably benign 0.00
R7597:Trpm8 UTSW 1 88328196 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTGAAGACGTGGATGTGGG -3'
(R):5'- CGGAGAATCCAAATTCAGCCT -3'

Sequencing Primer
(F):5'- AAGACGTGGATGTGGGGGTTAG -3'
(R):5'- CTGCTTGAAACCCTACCTAGG -3'
Posted On2018-04-02