Incidental Mutation 'R6299:Snrnp200'
ID508946
Institutional Source Beutler Lab
Gene Symbol Snrnp200
Ensembl Gene ENSMUSG00000003660
Gene Namesmall nuclear ribonucleoprotein 200 (U5)
SynonymsHELIC2, U5-200KD, A330064G03Rik, Ascc3l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6299 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location127208386-127240451 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 127222161 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 689 (Y689*)
Ref Sequence ENSEMBL: ENSMUSP00000099509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103220]
Predicted Effect probably null
Transcript: ENSMUST00000103220
AA Change: Y689*
SMART Domains Protein: ENSMUSP00000099509
Gene: ENSMUSG00000003660
AA Change: Y689*

DomainStartEndE-ValueType
low complexity region 65 78 N/A INTRINSIC
low complexity region 206 223 N/A INTRINSIC
low complexity region 373 386 N/A INTRINSIC
DEXDc 477 690 2.63e-30 SMART
AAA 495 680 5.77e-2 SMART
HELICc 768 860 3.76e-17 SMART
low complexity region 876 887 N/A INTRINSIC
Sec63 981 1286 2.62e-128 SMART
DEXDc 1324 1528 1.43e-31 SMART
AAA 1342 1533 2.39e0 SMART
HELICc 1607 1695 1.26e-9 SMART
Sec63 1812 2124 1.39e-118 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140868
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142327
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: On February 19, 2002, this locus was switched from human to mouse. The source accession, Z70200.1, is almost identical to the mouse BAC clone AC074224, and it matches the mouse cDNA accession BC011390 as well. The human gene is LocusID 23020. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a transgenic gene disruption exhibit embryonic lethality before implantation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 G A 6: 118,418,515 R24W probably damaging Het
C130050O18Rik A T 5: 139,414,371 S60C probably damaging Het
Cabcoco1 A G 10: 68,436,890 Y222H probably damaging Het
Cc2d1b T C 4: 108,628,138 V559A probably benign Het
Cgrrf1 T A 14: 46,840,190 N46K probably damaging Het
Clca3a1 T C 3: 144,758,514 D114G probably damaging Het
Clcnkb T A 4: 141,410,723 L279F probably damaging Het
Cr2 T C 1: 195,168,646 T151A probably damaging Het
Creb3l3 C T 10: 81,088,613 E236K probably damaging Het
Dcstamp T A 15: 39,755,203 V336D probably damaging Het
Dopey1 T G 9: 86,504,212 F379V probably damaging Het
Esf1 T C 2: 140,123,634 K714R possibly damaging Het
Exoc3l4 A T 12: 111,422,079 M1L possibly damaging Het
Extl3 T C 14: 65,076,672 R354G probably benign Het
Fastkd3 T C 13: 68,587,736 L535P probably damaging Het
Gab2 A G 7: 97,081,859 T12A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Golga4 T A 9: 118,557,370 S1187T probably benign Het
Haus3 A G 5: 34,167,796 V173A probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hspg2 A G 4: 137,544,705 Y2566C probably damaging Het
Inpp5f A T 7: 128,636,160 T34S possibly damaging Het
Iqck G A 7: 118,876,262 G70S unknown Het
Jade1 T C 3: 41,613,725 F743L probably damaging Het
Kif5a T C 10: 127,233,821 K845R probably damaging Het
Klhl30 A G 1: 91,357,914 probably null Het
Map2k1 T C 9: 64,214,490 D67G possibly damaging Het
Mcm9 A C 10: 53,537,681 C434W probably damaging Het
Muc4 T G 16: 32,752,035 S638A possibly damaging Het
Nectin3 A G 16: 46,463,982 V113A probably damaging Het
Nfya T C 17: 48,392,910 probably benign Het
Nup155 G T 15: 8,128,438 A460S possibly damaging Het
Nup210 T C 6: 91,074,288 E371G possibly damaging Het
Olfm3 T C 3: 115,120,983 S228P probably damaging Het
Olfr659 C A 7: 104,670,868 D55E probably benign Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Plin1 A C 7: 79,721,476 V500G probably benign Het
Ppfia1 A C 7: 144,510,312 M513R probably benign Het
Ppp1cb T A 5: 32,483,454 C27* probably null Het
Prss22 T A 17: 23,996,434 I123F probably damaging Het
Rbm24 G T 13: 46,419,073 V15L probably damaging Het
Reln T C 5: 22,286,944 T97A possibly damaging Het
Sipa1l2 T C 8: 125,453,464 T1065A possibly damaging Het
Sipa1l3 A C 7: 29,366,549 probably null Het
Srcap T C 7: 127,530,454 probably benign Het
Sv2a T C 3: 96,188,249 probably null Het
Tcf12 A T 9: 71,858,929 V474D probably damaging Het
Tpcn2 A T 7: 145,262,243 S403T probably damaging Het
Trim65 C A 11: 116,126,551 A362S probably benign Het
Trmt1 T A 8: 84,697,290 C36* probably null Het
Trpm8 T A 1: 88,354,479 L699Q probably damaging Het
Ube2m A C 7: 13,035,870 I116R probably damaging Het
Ulk1 T C 5: 110,791,097 K492E possibly damaging Het
Usp40 T A 1: 87,997,927 K193N probably damaging Het
Vmn1r3 A G 4: 3,185,098 S70P possibly damaging Het
Vmn2r2 T A 3: 64,116,653 K836* probably null Het
Vmn2r75 T A 7: 86,165,274 H337L probably benign Het
Wars G A 12: 108,861,383 T437M probably benign Het
Zdhhc5 T C 2: 84,690,481 T451A probably benign Het
Zfp788 T G 7: 41,648,541 H180Q possibly damaging Het
Zkscan7 A G 9: 122,888,717 E59G probably damaging Het
Other mutations in Snrnp200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00482:Snrnp200 APN 2 127230135 missense possibly damaging 0.80
IGL01013:Snrnp200 APN 2 127232472 missense probably damaging 1.00
IGL01073:Snrnp200 APN 2 127214912 splice site probably benign
IGL01319:Snrnp200 APN 2 127230127 splice site probably benign
IGL01597:Snrnp200 APN 2 127238732 unclassified probably benign
IGL01631:Snrnp200 APN 2 127238824 unclassified probably benign
IGL01646:Snrnp200 APN 2 127222228 missense probably benign 0.00
IGL02019:Snrnp200 APN 2 127232905 missense possibly damaging 0.94
IGL02158:Snrnp200 APN 2 127237483 missense probably benign 0.05
IGL02269:Snrnp200 APN 2 127229991 missense possibly damaging 0.67
IGL02288:Snrnp200 APN 2 127229895 missense probably damaging 1.00
IGL02437:Snrnp200 APN 2 127216110 missense probably damaging 1.00
IGL02476:Snrnp200 APN 2 127217488 missense probably benign 0.41
IGL02613:Snrnp200 APN 2 127218426 missense probably damaging 0.98
IGL02898:Snrnp200 APN 2 127216756 splice site probably benign
IGL03108:Snrnp200 APN 2 127238167 missense possibly damaging 0.82
IGL03143:Snrnp200 APN 2 127230042 critical splice donor site probably benign
IGL03237:Snrnp200 APN 2 127233313 missense probably damaging 0.99
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0012:Snrnp200 UTSW 2 127228549 missense probably benign 0.35
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0033:Snrnp200 UTSW 2 127238063 missense probably damaging 0.97
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0047:Snrnp200 UTSW 2 127234954 splice site probably benign
R0057:Snrnp200 UTSW 2 127237907 missense probably damaging 0.96
R0270:Snrnp200 UTSW 2 127232982 missense probably damaging 0.97
R0626:Snrnp200 UTSW 2 127221814 missense possibly damaging 0.46
R0731:Snrnp200 UTSW 2 127226145 splice site probably benign
R1175:Snrnp200 UTSW 2 127229077 missense probably damaging 1.00
R1184:Snrnp200 UTSW 2 127236817 missense probably damaging 1.00
R1383:Snrnp200 UTSW 2 127218411 missense probably benign 0.10
R1444:Snrnp200 UTSW 2 127228238 splice site probably benign
R1757:Snrnp200 UTSW 2 127232443 missense probably damaging 1.00
R1794:Snrnp200 UTSW 2 127216736 missense probably benign
R1808:Snrnp200 UTSW 2 127219027 critical splice acceptor site probably null
R1808:Snrnp200 UTSW 2 127219028 critical splice acceptor site probably null
R1957:Snrnp200 UTSW 2 127216175 missense possibly damaging 0.69
R2007:Snrnp200 UTSW 2 127227048 missense probably damaging 1.00
R2039:Snrnp200 UTSW 2 127234984 missense probably benign 0.19
R2070:Snrnp200 UTSW 2 127212403 missense possibly damaging 0.89
R2070:Snrnp200 UTSW 2 127237883 missense probably benign 0.00
R2892:Snrnp200 UTSW 2 127231777 missense probably damaging 0.99
R3236:Snrnp200 UTSW 2 127221882 missense probably damaging 1.00
R3862:Snrnp200 UTSW 2 127233099 splice site probably benign
R4028:Snrnp200 UTSW 2 127237566 missense probably damaging 0.99
R4105:Snrnp200 UTSW 2 127228016 missense probably damaging 1.00
R4328:Snrnp200 UTSW 2 127222217 missense probably damaging 0.99
R4471:Snrnp200 UTSW 2 127238753 missense probably benign 0.03
R4526:Snrnp200 UTSW 2 127229102 missense probably benign
R4575:Snrnp200 UTSW 2 127235066 missense probably benign 0.00
R4710:Snrnp200 UTSW 2 127226133 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127217414 missense probably damaging 1.00
R4728:Snrnp200 UTSW 2 127227878 missense possibly damaging 0.89
R4729:Snrnp200 UTSW 2 127232937 missense probably damaging 0.99
R4828:Snrnp200 UTSW 2 127211607 missense probably damaging 0.99
R5082:Snrnp200 UTSW 2 127226370 nonsense probably null
R5213:Snrnp200 UTSW 2 127231741 missense probably damaging 1.00
R5287:Snrnp200 UTSW 2 127231687 missense probably benign 0.13
R5486:Snrnp200 UTSW 2 127233066 missense possibly damaging 0.82
R5595:Snrnp200 UTSW 2 127226013 missense probably damaging 0.99
R5598:Snrnp200 UTSW 2 127226087 missense possibly damaging 0.64
R5681:Snrnp200 UTSW 2 127225135 missense probably damaging 1.00
R6207:Snrnp200 UTSW 2 127210735 missense probably benign 0.00
R6258:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6259:Snrnp200 UTSW 2 127218423 missense possibly damaging 0.60
R6434:Snrnp200 UTSW 2 127238654 missense probably damaging 1.00
R6522:Snrnp200 UTSW 2 127221827 missense probably benign 0.12
R6647:Snrnp200 UTSW 2 127226452 missense probably damaging 1.00
R6785:Snrnp200 UTSW 2 127229165 missense possibly damaging 0.70
R7027:Snrnp200 UTSW 2 127217272 missense probably benign 0.09
R7358:Snrnp200 UTSW 2 127221826 missense probably benign 0.03
R7436:Snrnp200 UTSW 2 127226484 critical splice donor site probably null
R7587:Snrnp200 UTSW 2 127227902 missense probably damaging 1.00
R7672:Snrnp200 UTSW 2 127221902 missense probably damaging 1.00
R7731:Snrnp200 UTSW 2 127229102 missense probably benign
RF016:Snrnp200 UTSW 2 127230556 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTTGTTACCCAGGCAGTCTTC -3'
(R):5'- GGTGAGTCATGCTATTACCTTGTC -3'

Sequencing Primer
(F):5'- ACCCAGGCAGTCTTCCTGTTC -3'
(R):5'- TTTAATCCCAGCACTTGAGAGGC -3'
Posted On2018-04-02