Incidental Mutation 'R6299:Vmn1r3'
ID508953
Institutional Source Beutler Lab
Gene Symbol Vmn1r3
Ensembl Gene ENSMUSG00000115466
Gene Namevomeronasal 1 receptor 3
SynonymsGm11778
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.297) question?
Stock #R6299 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location3184348-3185358 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 3185098 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 70 (S70P)
Ref Sequence ENSEMBL: ENSMUSP00000100790 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000105159]
Predicted Effect possibly damaging
Transcript: ENSMUST00000105159
AA Change: S70P

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100790
Gene: ENSMUSG00000115466
AA Change: S70P

DomainStartEndE-ValueType
Pfam:TAS2R 6 302 1.7e-9 PFAM
Pfam:7tm_1 30 292 5.1e-7 PFAM
Pfam:V1R 34 298 1.2e-35 PFAM
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (61/61)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 G A 6: 118,418,515 R24W probably damaging Het
C130050O18Rik A T 5: 139,414,371 S60C probably damaging Het
Cabcoco1 A G 10: 68,436,890 Y222H probably damaging Het
Cc2d1b T C 4: 108,628,138 V559A probably benign Het
Cgrrf1 T A 14: 46,840,190 N46K probably damaging Het
Clca3a1 T C 3: 144,758,514 D114G probably damaging Het
Clcnkb T A 4: 141,410,723 L279F probably damaging Het
Cr2 T C 1: 195,168,646 T151A probably damaging Het
Creb3l3 C T 10: 81,088,613 E236K probably damaging Het
Dcstamp T A 15: 39,755,203 V336D probably damaging Het
Dopey1 T G 9: 86,504,212 F379V probably damaging Het
Esf1 T C 2: 140,123,634 K714R possibly damaging Het
Exoc3l4 A T 12: 111,422,079 M1L possibly damaging Het
Extl3 T C 14: 65,076,672 R354G probably benign Het
Fastkd3 T C 13: 68,587,736 L535P probably damaging Het
Gab2 A G 7: 97,081,859 T12A probably benign Het
Gm10549 C A 18: 33,464,305 probably benign Het
Golga4 T A 9: 118,557,370 S1187T probably benign Het
Haus3 A G 5: 34,167,796 V173A probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hspg2 A G 4: 137,544,705 Y2566C probably damaging Het
Inpp5f A T 7: 128,636,160 T34S possibly damaging Het
Iqck G A 7: 118,876,262 G70S unknown Het
Jade1 T C 3: 41,613,725 F743L probably damaging Het
Kif5a T C 10: 127,233,821 K845R probably damaging Het
Klhl30 A G 1: 91,357,914 probably null Het
Map2k1 T C 9: 64,214,490 D67G possibly damaging Het
Mcm9 A C 10: 53,537,681 C434W probably damaging Het
Muc4 T G 16: 32,752,035 S638A possibly damaging Het
Nectin3 A G 16: 46,463,982 V113A probably damaging Het
Nfya T C 17: 48,392,910 probably benign Het
Nup155 G T 15: 8,128,438 A460S possibly damaging Het
Nup210 T C 6: 91,074,288 E371G possibly damaging Het
Olfm3 T C 3: 115,120,983 S228P probably damaging Het
Olfr659 C A 7: 104,670,868 D55E probably benign Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Plin1 A C 7: 79,721,476 V500G probably benign Het
Ppfia1 A C 7: 144,510,312 M513R probably benign Het
Ppp1cb T A 5: 32,483,454 C27* probably null Het
Prss22 T A 17: 23,996,434 I123F probably damaging Het
Rbm24 G T 13: 46,419,073 V15L probably damaging Het
Reln T C 5: 22,286,944 T97A possibly damaging Het
Sipa1l2 T C 8: 125,453,464 T1065A possibly damaging Het
Sipa1l3 A C 7: 29,366,549 probably null Het
Snrnp200 T A 2: 127,222,161 Y689* probably null Het
Srcap T C 7: 127,530,454 probably benign Het
Sv2a T C 3: 96,188,249 probably null Het
Tcf12 A T 9: 71,858,929 V474D probably damaging Het
Tpcn2 A T 7: 145,262,243 S403T probably damaging Het
Trim65 C A 11: 116,126,551 A362S probably benign Het
Trmt1 T A 8: 84,697,290 C36* probably null Het
Trpm8 T A 1: 88,354,479 L699Q probably damaging Het
Ube2m A C 7: 13,035,870 I116R probably damaging Het
Ulk1 T C 5: 110,791,097 K492E possibly damaging Het
Usp40 T A 1: 87,997,927 K193N probably damaging Het
Vmn2r2 T A 3: 64,116,653 K836* probably null Het
Vmn2r75 T A 7: 86,165,274 H337L probably benign Het
Wars G A 12: 108,861,383 T437M probably benign Het
Zdhhc5 T C 2: 84,690,481 T451A probably benign Het
Zfp788 T G 7: 41,648,541 H180Q possibly damaging Het
Zkscan7 A G 9: 122,888,717 E59G probably damaging Het
Other mutations in Vmn1r3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03130:Vmn1r3 APN 4 3185214 missense possibly damaging 0.89
PIT4131001:Vmn1r3 UTSW 4 3184691 missense probably damaging 1.00
PIT4131001:Vmn1r3 UTSW 4 3184774 missense probably benign 0.02
PIT4142001:Vmn1r3 UTSW 4 3184691 missense probably damaging 1.00
PIT4142001:Vmn1r3 UTSW 4 3184774 missense probably benign 0.02
R0972:Vmn1r3 UTSW 4 3185125 missense probably damaging 1.00
R1423:Vmn1r3 UTSW 4 3185231 missense probably damaging 1.00
R3902:Vmn1r3 UTSW 4 3185241 missense probably benign 0.41
R4999:Vmn1r3 UTSW 4 3185009 nonsense probably null
R6091:Vmn1r3 UTSW 4 3184684 missense probably damaging 0.97
R6140:Vmn1r3 UTSW 4 3185031 missense probably damaging 0.97
R6188:Vmn1r3 UTSW 4 3185017 missense probably damaging 1.00
R6303:Vmn1r3 UTSW 4 3184975 missense probably damaging 1.00
R6304:Vmn1r3 UTSW 4 3184975 missense probably damaging 1.00
R6317:Vmn1r3 UTSW 4 3184993 missense probably benign 0.39
R6430:Vmn1r3 UTSW 4 3184971 missense probably benign
R6633:Vmn1r3 UTSW 4 3184971 missense probably benign
Predicted Primers PCR Primer
(F):5'- TGTTTAGAAGCAGGTGCACAAG -3'
(R):5'- TTTCTCTTCTGCCAGATTACAGTGG -3'

Sequencing Primer
(F):5'- CAGGAGGGACCAATGTACTTG -3'
(R):5'- GGGAATGTTTGGCAATTCCTCAATC -3'
Posted On2018-04-02