Incidental Mutation 'R6299:Gab2'
ID508970
Institutional Source Beutler Lab
Gene Symbol Gab2
Ensembl Gene ENSMUSG00000004508
Gene Namegrowth factor receptor bound protein 2-associated protein 2
SynonymsD130058I17Rik, p97
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.319) question?
Stock #R6299 (G1)
Quality Score169.009
Status Validated
Chromosome7
Chromosomal Location97081586-97308946 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 97081859 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 12 (T12A)
Ref Sequence ENSEMBL: ENSMUSP00000146200 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000004622] [ENSMUST00000206791]
Predicted Effect probably benign
Transcript: ENSMUST00000004622
AA Change: T12A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000004622
Gene: ENSMUSG00000004508
AA Change: T12A

DomainStartEndE-ValueType
PH 9 121 1.07e-22 SMART
Blast:PH 268 314 4e-11 BLAST
low complexity region 348 355 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000206791
AA Change: T12A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.4%
  • 20x: 98.2%
Validation Efficiency 100% (61/61)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the GRB2-associated binding protein (GAB) gene family. These proteins contain pleckstrin homology (PH) domain, and bind SHP2 tyrosine phosphatase and GRB2 adapter protein. They act as adapters for transmitting various signals in response to stimuli through cytokine and growth factor receptors, and T- and B-cell antigen receptors. The protein encoded by this gene is the principal activator of phosphatidylinositol-3 kinase in response to activation of the high affinity IgE receptor. Two alternatively spliced transcripts encoding different isoforms have been described for this gene. [provided by RefSeq, Nov 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in passive cutaneous and systemic anaphylaxis, Fc gamma receptor-mediated phagocytosis, and mast cell development. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bms1 G A 6: 118,418,515 R24W probably damaging Het
C130050O18Rik A T 5: 139,414,371 S60C probably damaging Het
Cabcoco1 A G 10: 68,436,890 Y222H probably damaging Het
Cc2d1b T C 4: 108,628,138 V559A probably benign Het
Cgrrf1 T A 14: 46,840,190 N46K probably damaging Het
Clca3a1 T C 3: 144,758,514 D114G probably damaging Het
Clcnkb T A 4: 141,410,723 L279F probably damaging Het
Cr2 T C 1: 195,168,646 T151A probably damaging Het
Creb3l3 C T 10: 81,088,613 E236K probably damaging Het
Dcstamp T A 15: 39,755,203 V336D probably damaging Het
Dopey1 T G 9: 86,504,212 F379V probably damaging Het
Esf1 T C 2: 140,123,634 K714R possibly damaging Het
Exoc3l4 A T 12: 111,422,079 M1L possibly damaging Het
Extl3 T C 14: 65,076,672 R354G probably benign Het
Fastkd3 T C 13: 68,587,736 L535P probably damaging Het
Gm10549 C A 18: 33,464,305 probably benign Het
Golga4 T A 9: 118,557,370 S1187T probably benign Het
Haus3 A G 5: 34,167,796 V173A probably benign Het
Herc2 T A 7: 56,135,055 Y1416N possibly damaging Het
Hspg2 A G 4: 137,544,705 Y2566C probably damaging Het
Inpp5f A T 7: 128,636,160 T34S possibly damaging Het
Iqck G A 7: 118,876,262 G70S unknown Het
Jade1 T C 3: 41,613,725 F743L probably damaging Het
Kif5a T C 10: 127,233,821 K845R probably damaging Het
Klhl30 A G 1: 91,357,914 probably null Het
Map2k1 T C 9: 64,214,490 D67G possibly damaging Het
Mcm9 A C 10: 53,537,681 C434W probably damaging Het
Muc4 T G 16: 32,752,035 S638A possibly damaging Het
Nectin3 A G 16: 46,463,982 V113A probably damaging Het
Nfya T C 17: 48,392,910 probably benign Het
Nup155 G T 15: 8,128,438 A460S possibly damaging Het
Nup210 T C 6: 91,074,288 E371G possibly damaging Het
Olfm3 T C 3: 115,120,983 S228P probably damaging Het
Olfr659 C A 7: 104,670,868 D55E probably benign Het
Olfr916 A T 9: 38,657,777 I205N possibly damaging Het
Plin1 A C 7: 79,721,476 V500G probably benign Het
Ppfia1 A C 7: 144,510,312 M513R probably benign Het
Ppp1cb T A 5: 32,483,454 C27* probably null Het
Prss22 T A 17: 23,996,434 I123F probably damaging Het
Rbm24 G T 13: 46,419,073 V15L probably damaging Het
Reln T C 5: 22,286,944 T97A possibly damaging Het
Sipa1l2 T C 8: 125,453,464 T1065A possibly damaging Het
Sipa1l3 A C 7: 29,366,549 probably null Het
Snrnp200 T A 2: 127,222,161 Y689* probably null Het
Srcap T C 7: 127,530,454 probably benign Het
Sv2a T C 3: 96,188,249 probably null Het
Tcf12 A T 9: 71,858,929 V474D probably damaging Het
Tpcn2 A T 7: 145,262,243 S403T probably damaging Het
Trim65 C A 11: 116,126,551 A362S probably benign Het
Trmt1 T A 8: 84,697,290 C36* probably null Het
Trpm8 T A 1: 88,354,479 L699Q probably damaging Het
Ube2m A C 7: 13,035,870 I116R probably damaging Het
Ulk1 T C 5: 110,791,097 K492E possibly damaging Het
Usp40 T A 1: 87,997,927 K193N probably damaging Het
Vmn1r3 A G 4: 3,185,098 S70P possibly damaging Het
Vmn2r2 T A 3: 64,116,653 K836* probably null Het
Vmn2r75 T A 7: 86,165,274 H337L probably benign Het
Wars G A 12: 108,861,383 T437M probably benign Het
Zdhhc5 T C 2: 84,690,481 T451A probably benign Het
Zfp788 T G 7: 41,648,541 H180Q possibly damaging Het
Zkscan7 A G 9: 122,888,717 E59G probably damaging Het
Other mutations in Gab2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00091:Gab2 APN 7 97302443 missense possibly damaging 0.91
IGL00325:Gab2 APN 7 97299258 missense probably damaging 1.00
IGL01832:Gab2 APN 7 97304238 missense probably damaging 1.00
IGL01955:Gab2 APN 7 97304223 missense probably damaging 1.00
IGL02664:Gab2 APN 7 97304182 missense probably damaging 1.00
R0105:Gab2 UTSW 7 97299072 missense probably damaging 1.00
R0105:Gab2 UTSW 7 97299072 missense probably damaging 1.00
R0243:Gab2 UTSW 7 97299241 missense probably damaging 0.96
R0827:Gab2 UTSW 7 97300332 missense probably damaging 1.00
R1696:Gab2 UTSW 7 97223633 missense probably damaging 1.00
R1872:Gab2 UTSW 7 97299043 missense probably damaging 0.99
R2973:Gab2 UTSW 7 97223552 missense probably benign 0.07
R3195:Gab2 UTSW 7 97272029 missense probably benign
R3827:Gab2 UTSW 7 97223741 missense probably damaging 1.00
R3910:Gab2 UTSW 7 97299073 missense probably damaging 1.00
R3911:Gab2 UTSW 7 97299073 missense probably damaging 1.00
R3912:Gab2 UTSW 7 97299073 missense probably damaging 1.00
R4604:Gab2 UTSW 7 97304213 missense probably damaging 0.99
R5506:Gab2 UTSW 7 97303113 missense probably damaging 1.00
R5655:Gab2 UTSW 7 97298892 missense probably benign
R7038:Gab2 UTSW 7 97303083 missense probably damaging 1.00
R7313:Gab2 UTSW 7 97081798 start gained probably benign
R7586:Gab2 UTSW 7 97301438 missense probably damaging 1.00
R7729:Gab2 UTSW 7 97301426 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGTGGGGTCCAGGCTAACT -3'
(R):5'- AATCGCTCCAAACTTCGGCTC -3'

Sequencing Primer
(F):5'- TAACTGGCCTCTGCGCC -3'
(R):5'- AAACTTCGGCTCGGCGAG -3'
Posted On2018-04-02